Mutagenetix > Incidental Mutation

Incidental Mutation 'R6176:Atrn'

487740

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

044318-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6176 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130946091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 271 (E271G)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably benign
Transcript: ENSMUST00000028781
AA Change: E271G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: E271G

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	T	C	4: 63,377,732	Q966R	probably benign	Het
Amn	A	G	12: 111,274,156	D74G	possibly damaging	Het
Ank2	T	A	3: 126,945,471	T2255S	probably benign	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Apaf1	A	G	10: 91,059,571		probably null	Het
Asl	T	A	5: 130,018,879	H82L	probably benign	Het
B4galnt3	A	G	6: 120,224,164	F184S	probably damaging	Het
C1s2	T	A	6: 124,625,809	H481L	probably damaging	Het
Cav2	A	G	6: 17,286,919	D58G	possibly damaging	Het
Cc2d2a	A	T	5: 43,709,113	H755L	probably benign	Het
Ccdc65	A	G	15: 98,708,552		probably null	Het
Celsr3	A	T	9: 108,828,355	Y679F	probably damaging	Het
Cep135	A	T	5: 76,624,643	Y625F	probably benign	Het
Cfhr1	A	G	1: 139,550,916	S58P	probably damaging	Het
Clip4	T	A	17: 71,806,633	C259*	probably null	Het
Cyp2j12	T	A	4: 96,140,837	Q69L	probably damaging	Het
Dirc2	C	T	16: 35,704,797	M426I	probably benign	Het
Dock3	G	A	9: 106,912,948	T1484I	probably benign	Het
Ecscr	CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	18: 35,716,760		probably benign	Het
Fam43b	T	C	4: 138,395,211	D266G	probably damaging	Het
Fbxl13	T	A	5: 21,500,500	I618F	possibly damaging	Het
Gm10229	T	A	16: 89,015,400	Y24*	probably null	Het
Gm11639	A	T	11: 104,792,557	I1604F	probably benign	Het
Gm13212	T	A	4: 145,624,058	C688*	probably null	Het
Gne	C	T	4: 44,053,019		probably benign	Het
Gnpat	T	A	8: 124,878,854	V321E	probably damaging	Het
Gpatch8	G	A	11: 102,487,524	A200V	unknown	Het
Grid1	C	A	14: 35,562,547	A749E	probably benign	Het
Grip2	C	T	6: 91,779,851	V540I	probably benign	Het
Ice2	C	T	9: 69,417,072	T759M	probably damaging	Het
Jrk	G	T	15: 74,706,340	N365K	possibly damaging	Het
Kank4	A	G	4: 98,765,554	I879T	probably damaging	Het
Lao1	T	A	4: 118,962,000	M1K	probably null	Het
Mlf1	A	G	3: 67,384,594	R31G	probably damaging	Het
Nt5c3b	T	C	11: 100,440,148		probably benign	Het
Nusap1	A	G	2: 119,630,421	R132G	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1153	G	A	2: 87,896,936	V254I	probably benign	Het
Olfr738	A	G	14: 50,414,390	Y282C	probably damaging	Het
Olfr926	A	C	9: 38,877,377	D67A	probably damaging	Het
Paqr9	G	T	9: 95,560,775	V273L	possibly damaging	Het
Pcdha9	A	T	18: 36,998,931	D351V	probably benign	Het
Pcdhga1	A	G	18: 37,664,229	D762G	probably benign	Het
Pde3a	T	A	6: 141,498,889	L1141Q	possibly damaging	Het
Pga5	T	A	19: 10,671,785		probably null	Het
Phldb3	C	A	7: 24,626,702	R570S	probably damaging	Het
Slc22a6	A	C	19: 8,621,797	E264A	probably damaging	Het
Slit1	T	C	19: 41,637,595	K576R	probably damaging	Het
Sox21	T	C	14: 118,235,628	K3R	possibly damaging	Het
Stk32c	A	T	7: 139,120,775	D297E	probably benign	Het
Suclg1	T	C	6: 73,275,343	V323A	probably damaging	Het
Tas1r2	T	G	4: 139,668,888	C513G	probably damaging	Het
Tbc1d23	A	G	16: 57,171,789	Y603H	probably damaging	Het
Tbc1d31	T	C	15: 57,952,796	V642A	probably damaging	Het
Tle2	A	T	10: 81,587,334	D486V	probably damaging	Het
Tmem232	A	G	17: 65,485,872	I110T	probably damaging	Het
Tmem39b	A	G	4: 129,693,101	Y106H	probably damaging	Het
Trpm4	T	G	7: 45,326,676	N229T	probably damaging	Het
Tspo	A	G	15: 83,573,806	T120A	probably benign	Het
Ttc28	G	A	5: 111,223,985	A767T	probably damaging	Het
Usp53	G	A	3: 122,934,003	Q977*	probably null	Het
Vmn1r215	T	A	13: 23,076,358	D189E	probably damaging	Het
Vmn2r12	T	C	5: 109,086,000	Y782C	probably benign	Het
Vmn2r54	A	G	7: 12,615,981	L558P	probably damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAGTCACACTTGCAAATG -3'
(R):5'- CGTATGGCTGCTAAAATAAACTCCC -3'

Sequencing Primer
(F):5'- TGCAGTCACACTTGCAAATGAACTG -3'
(R):5'- TGGCTGCTAAAATAAACTCCCTACAG -3'

Posted On

2017-10-10