Mutagenetix > Incidental Mutations

Incidental Mutation 'R6176:Kank4'

487746

Institutional Source

Beutler Lab

Gene Symbol

Kank4

Ensembl Gene

ENSMUSG00000035407

Gene Name

KN motif and ankyrin repeat domains 4

Synonyms

Ankrd38

MMRRC Submission

044318-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6176 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98754898-98817537 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98765554 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 879 (I879T)

Ref Sequence

ENSEMBL: ENSMUSP00000099851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102790]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102790
AA Change: I879T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: I879T

Domain	Start	End	E-Value	Type
Pfam:KN_motif	24	62	5.6e-26	PFAM
low complexity region	280	295	N/A	INTRINSIC
low complexity region	300	320	N/A	INTRINSIC
coiled coil region	345	409	N/A	INTRINSIC
low complexity region	505	521	N/A	INTRINSIC
low complexity region	600	624	N/A	INTRINSIC
low complexity region	625	655	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
ANK	838	868	7.42e-4	SMART
ANK	877	905	2.08e3	SMART
ANK	910	939	1.11e-2	SMART
ANK	943	973	8.99e-3	SMART
ANK	977	1006	2.43e3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137270

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (60/62)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	T	C	4: 63,377,732	Q966R	probably benign	Het
Amn	A	G	12: 111,274,156	D74G	possibly damaging	Het
Ank2	T	A	3: 126,945,471	T2255S	probably benign	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Apaf1	A	G	10: 91,059,571		probably null	Het
Asl	T	A	5: 130,018,879	H82L	probably benign	Het
Atrn	A	G	2: 130,946,091	E271G	probably benign	Het
B4galnt3	A	G	6: 120,224,164	F184S	probably damaging	Het
C1s2	T	A	6: 124,625,809	H481L	probably damaging	Het
Cav2	A	G	6: 17,286,919	D58G	possibly damaging	Het
Cc2d2a	A	T	5: 43,709,113	H755L	probably benign	Het
Ccdc65	A	G	15: 98,708,552		probably null	Het
Celsr3	A	T	9: 108,828,355	Y679F	probably damaging	Het
Cep135	A	T	5: 76,624,643	Y625F	probably benign	Het
Cfhr1	A	G	1: 139,550,916	S58P	probably damaging	Het
Clip4	T	A	17: 71,806,633	C259*	probably null	Het
Cyp2j12	T	A	4: 96,140,837	Q69L	probably damaging	Het
Dirc2	C	T	16: 35,704,797	M426I	probably benign	Het
Dock3	G	A	9: 106,912,948	T1484I	probably benign	Het
Ecscr	CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	18: 35,716,760		probably benign	Het
Fam43b	T	C	4: 138,395,211	D266G	probably damaging	Het
Fbxl13	T	A	5: 21,500,500	I618F	possibly damaging	Het
Gm10229	T	A	16: 89,015,400	Y24*	probably null	Het
Gm11639	A	T	11: 104,792,557	I1604F	probably benign	Het
Gm13212	T	A	4: 145,624,058	C688*	probably null	Het
Gne	C	T	4: 44,053,019		probably benign	Het
Gnpat	T	A	8: 124,878,854	V321E	probably damaging	Het
Gpatch8	G	A	11: 102,487,524	A200V	unknown	Het
Grid1	C	A	14: 35,562,547	A749E	probably benign	Het
Grip2	C	T	6: 91,779,851	V540I	probably benign	Het
Ice2	C	T	9: 69,417,072	T759M	probably damaging	Het
Jrk	G	T	15: 74,706,340	N365K	possibly damaging	Het
Lao1	T	A	4: 118,962,000	M1K	probably null	Het
Mlf1	A	G	3: 67,384,594	R31G	probably damaging	Het
Nt5c3b	T	C	11: 100,440,148		probably benign	Het
Nusap1	A	G	2: 119,630,421	R132G	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1153	G	A	2: 87,896,936	V254I	probably benign	Het
Olfr738	A	G	14: 50,414,390	Y282C	probably damaging	Het
Olfr926	A	C	9: 38,877,377	D67A	probably damaging	Het
Paqr9	G	T	9: 95,560,775	V273L	possibly damaging	Het
Pcdha9	A	T	18: 36,998,931	D351V	probably benign	Het
Pcdhga1	A	G	18: 37,664,229	D762G	probably benign	Het
Pde3a	T	A	6: 141,498,889	L1141Q	possibly damaging	Het
Pga5	T	A	19: 10,671,785		probably null	Het
Phldb3	C	A	7: 24,626,702	R570S	probably damaging	Het
Slc22a6	A	C	19: 8,621,797	E264A	probably damaging	Het
Slit1	T	C	19: 41,637,595	K576R	probably damaging	Het
Sox21	T	C	14: 118,235,628	K3R	possibly damaging	Het
Stk32c	A	T	7: 139,120,775	D297E	probably benign	Het
Suclg1	T	C	6: 73,275,343	V323A	probably damaging	Het
Tas1r2	T	G	4: 139,668,888	C513G	probably damaging	Het
Tbc1d23	A	G	16: 57,171,789	Y603H	probably damaging	Het
Tbc1d31	T	C	15: 57,952,796	V642A	probably damaging	Het
Tle2	A	T	10: 81,587,334	D486V	probably damaging	Het
Tmem232	A	G	17: 65,485,872	I110T	probably damaging	Het
Tmem39b	A	G	4: 129,693,101	Y106H	probably damaging	Het
Trpm4	T	G	7: 45,326,676	N229T	probably damaging	Het
Tspo	A	G	15: 83,573,806	T120A	probably benign	Het
Ttc28	G	A	5: 111,223,985	A767T	probably damaging	Het
Usp53	G	A	3: 122,934,003	Q977*	probably null	Het
Vmn1r215	T	A	13: 23,076,358	D189E	probably damaging	Het
Vmn2r12	T	C	5: 109,086,000	Y782C	probably benign	Het
Vmn2r54	A	G	7: 12,615,981	L558P	probably damaging	Het

Other mutations in Kank4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Kank4	APN	4	98778395	missense	probably damaging	0.99
IGL02634:Kank4	APN	4	98778827	missense	probably benign	0.06
IGL02883:Kank4	APN	4	98773453	missense	possibly damaging	0.87
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0081:Kank4	UTSW	4	98778330	missense	probably benign	0.02
R0219:Kank4	UTSW	4	98778465	missense	probably benign	0.06
R0498:Kank4	UTSW	4	98779636	missense	probably benign
R0609:Kank4	UTSW	4	98777105	missense	probably damaging	0.99
R0855:Kank4	UTSW	4	98771444	missense	probably damaging	1.00
R0865:Kank4	UTSW	4	98774663	splice site	probably benign
R0961:Kank4	UTSW	4	98756519	missense	probably benign	0.02
R1172:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1173:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1175:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1381:Kank4	UTSW	4	98779938	missense	probably damaging	0.98
R1517:Kank4	UTSW	4	98779029	missense	possibly damaging	0.83
R1573:Kank4	UTSW	4	98774836	nonsense	probably null
R1668:Kank4	UTSW	4	98778896	missense	probably damaging	0.98
R2051:Kank4	UTSW	4	98780102	missense	probably damaging	0.99
R2253:Kank4	UTSW	4	98779226	missense	probably damaging	0.99
R2656:Kank4	UTSW	4	98778957	missense	probably damaging	0.99
R3801:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3802:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3804:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3945:Kank4	UTSW	4	98771280	missense	probably damaging	1.00
R4172:Kank4	UTSW	4	98779121	missense	probably damaging	1.00
R4502:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R4503:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R5024:Kank4	UTSW	4	98785661	missense	probably damaging	0.99
R5105:Kank4	UTSW	4	98779159	missense	probably benign	0.01
R5122:Kank4	UTSW	4	98756567	missense	probably damaging	1.00
R5255:Kank4	UTSW	4	98778972	missense	probably benign
R5484:Kank4	UTSW	4	98774785	missense	probably benign
R5517:Kank4	UTSW	4	98774881	missense	probably damaging	1.00
R5550:Kank4	UTSW	4	98771441	missense	probably benign	0.27
R5667:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5671:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5865:Kank4	UTSW	4	98771393	missense	possibly damaging	0.50
R6778:Kank4	UTSW	4	98761505	missense	probably benign	0.01
R7084:Kank4	UTSW	4	98771345	missense	probably damaging	1.00
R7085:Kank4	UTSW	4	98779946	missense	probably benign
R7112:Kank4	UTSW	4	98761521	missense	probably damaging	0.99
R8307:Kank4	UTSW	4	98778678	nonsense	probably null
R8431:Kank4	UTSW	4	98779272	missense	probably benign	0.33
R8447:Kank4	UTSW	4	98778492	missense	probably damaging	0.99
R8483:Kank4	UTSW	4	98771378	missense	probably damaging	1.00
R8505:Kank4	UTSW	4	98785676	start gained	probably benign
X0027:Kank4	UTSW	4	98779923	missense	probably benign	0.00
Z1176:Kank4	UTSW	4	98778294	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCATGGATCTACACGGAATTC -3'
(R):5'- CTGTAGAGAAGGTGAGGCCATC -3'

Sequencing Primer
(F):5'- TGGATCTACACGGAATTCCTCAC -3'
(R):5'- TGGCTGCTAAAAATGTAAGCTG -3'

Posted On

2017-10-10