Incidental Mutation 'R6176:Fbxl13'
ID487752
Institutional Source Beutler Lab
Gene Symbol Fbxl13
Ensembl Gene ENSMUSG00000048520
Gene NameF-box and leucine-rich repeat protein 13
Synonyms4921539K22Rik
MMRRC Submission 044318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6176 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21483847-21645634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21500500 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 618 (I618F)
Ref Sequence ENSEMBL: ENSMUSP00000052716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051358
AA Change: I618F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: I618F

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,377,732 Q966R probably benign Het
Amn A G 12: 111,274,156 D74G possibly damaging Het
Ank2 T A 3: 126,945,471 T2255S probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Apaf1 A G 10: 91,059,571 probably null Het
Asl T A 5: 130,018,879 H82L probably benign Het
Atrn A G 2: 130,946,091 E271G probably benign Het
B4galnt3 A G 6: 120,224,164 F184S probably damaging Het
C1s2 T A 6: 124,625,809 H481L probably damaging Het
Cav2 A G 6: 17,286,919 D58G possibly damaging Het
Cc2d2a A T 5: 43,709,113 H755L probably benign Het
Ccdc65 A G 15: 98,708,552 probably null Het
Celsr3 A T 9: 108,828,355 Y679F probably damaging Het
Cep135 A T 5: 76,624,643 Y625F probably benign Het
Cfhr1 A G 1: 139,550,916 S58P probably damaging Het
Clip4 T A 17: 71,806,633 C259* probably null Het
Cyp2j12 T A 4: 96,140,837 Q69L probably damaging Het
Dirc2 C T 16: 35,704,797 M426I probably benign Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Ecscr CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 18: 35,716,760 probably benign Het
Fam43b T C 4: 138,395,211 D266G probably damaging Het
Gm10229 T A 16: 89,015,400 Y24* probably null Het
Gm11639 A T 11: 104,792,557 I1604F probably benign Het
Gm13212 T A 4: 145,624,058 C688* probably null Het
Gne C T 4: 44,053,019 probably benign Het
Gnpat T A 8: 124,878,854 V321E probably damaging Het
Gpatch8 G A 11: 102,487,524 A200V unknown Het
Grid1 C A 14: 35,562,547 A749E probably benign Het
Grip2 C T 6: 91,779,851 V540I probably benign Het
Ice2 C T 9: 69,417,072 T759M probably damaging Het
Jrk G T 15: 74,706,340 N365K possibly damaging Het
Kank4 A G 4: 98,765,554 I879T probably damaging Het
Lao1 T A 4: 118,962,000 M1K probably null Het
Mlf1 A G 3: 67,384,594 R31G probably damaging Het
Nt5c3b T C 11: 100,440,148 probably benign Het
Nusap1 A G 2: 119,630,421 R132G probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1153 G A 2: 87,896,936 V254I probably benign Het
Olfr738 A G 14: 50,414,390 Y282C probably damaging Het
Olfr926 A C 9: 38,877,377 D67A probably damaging Het
Paqr9 G T 9: 95,560,775 V273L possibly damaging Het
Pcdha9 A T 18: 36,998,931 D351V probably benign Het
Pcdhga1 A G 18: 37,664,229 D762G probably benign Het
Pde3a T A 6: 141,498,889 L1141Q possibly damaging Het
Pga5 T A 19: 10,671,785 probably null Het
Phldb3 C A 7: 24,626,702 R570S probably damaging Het
Slc22a6 A C 19: 8,621,797 E264A probably damaging Het
Slit1 T C 19: 41,637,595 K576R probably damaging Het
Sox21 T C 14: 118,235,628 K3R possibly damaging Het
Stk32c A T 7: 139,120,775 D297E probably benign Het
Suclg1 T C 6: 73,275,343 V323A probably damaging Het
Tas1r2 T G 4: 139,668,888 C513G probably damaging Het
Tbc1d23 A G 16: 57,171,789 Y603H probably damaging Het
Tbc1d31 T C 15: 57,952,796 V642A probably damaging Het
Tle2 A T 10: 81,587,334 D486V probably damaging Het
Tmem232 A G 17: 65,485,872 I110T probably damaging Het
Tmem39b A G 4: 129,693,101 Y106H probably damaging Het
Trpm4 T G 7: 45,326,676 N229T probably damaging Het
Tspo A G 15: 83,573,806 T120A probably benign Het
Ttc28 G A 5: 111,223,985 A767T probably damaging Het
Usp53 G A 3: 122,934,003 Q977* probably null Het
Vmn1r215 T A 13: 23,076,358 D189E probably damaging Het
Vmn2r12 T C 5: 109,086,000 Y782C probably benign Het
Vmn2r54 A G 7: 12,615,981 L558P probably damaging Het
Other mutations in Fbxl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Fbxl13 APN 5 21490414 missense possibly damaging 0.81
IGL02178:Fbxl13 APN 5 21620720 missense possibly damaging 0.56
IGL02271:Fbxl13 APN 5 21490456 missense probably damaging 1.00
IGL02317:Fbxl13 APN 5 21522234 missense probably benign 0.28
IGL02508:Fbxl13 APN 5 21556805 critical splice donor site probably null
IGL02891:Fbxl13 APN 5 21522100 splice site probably benign
IGL03387:Fbxl13 APN 5 21523798 critical splice donor site probably null
laurel UTSW 5 21582053 nonsense probably null
PIT4305001:Fbxl13 UTSW 5 21522148 missense probably benign
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0278:Fbxl13 UTSW 5 21523910 missense probably benign 0.03
R0597:Fbxl13 UTSW 5 21614714 missense probably benign 0.09
R1110:Fbxl13 UTSW 5 21484036 missense probably benign
R1172:Fbxl13 UTSW 5 21620604 splice site probably benign
R1175:Fbxl13 UTSW 5 21620604 splice site probably benign
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R2174:Fbxl13 UTSW 5 21582048 missense possibly damaging 0.74
R2426:Fbxl13 UTSW 5 21522137 missense probably damaging 1.00
R4171:Fbxl13 UTSW 5 21543788 missense probably benign 0.02
R4413:Fbxl13 UTSW 5 21582053 nonsense probably null
R4655:Fbxl13 UTSW 5 21582039 missense probably damaging 1.00
R4816:Fbxl13 UTSW 5 21484003 missense probably benign 0.25
R5544:Fbxl13 UTSW 5 21524491 missense probably damaging 0.96
R5979:Fbxl13 UTSW 5 21582091 missense probably damaging 1.00
R6211:Fbxl13 UTSW 5 21484021 missense possibly damaging 0.57
R6252:Fbxl13 UTSW 5 21621501 missense possibly damaging 0.96
R6336:Fbxl13 UTSW 5 21523547 critical splice donor site probably null
R6455:Fbxl13 UTSW 5 21556814 missense probably benign 0.02
R6522:Fbxl13 UTSW 5 21561556 unclassified probably null
R6827:Fbxl13 UTSW 5 21522178 missense probably damaging 0.97
R6961:Fbxl13 UTSW 5 21543742 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21543689 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21620613 missense probably null 0.03
R7152:Fbxl13 UTSW 5 21582067 missense possibly damaging 0.95
R7196:Fbxl13 UTSW 5 21486303 missense probably damaging 0.97
R7418:Fbxl13 UTSW 5 21581983 missense probably benign 0.00
R7490:Fbxl13 UTSW 5 21523060 nonsense probably null
R7649:Fbxl13 UTSW 5 21614666 missense probably benign 0.13
R7816:Fbxl13 UTSW 5 21543787 missense probably benign 0.11
R8036:Fbxl13 UTSW 5 21523568 missense probably damaging 1.00
R8098:Fbxl13 UTSW 5 21620718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACGACCGGAGTTGACTG -3'
(R):5'- TTACCAAAGTAAGCCCACAGTTTG -3'

Sequencing Primer
(F):5'- TTGACTGTGCGTGAGTCCCC -3'
(R):5'- GGACCCACAATGTACCTTTATTTAGC -3'
Posted On2017-10-10