Incidental Mutation 'R6176:Stk32c'
ID 487767
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission 044318-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6176 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138700691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 297 (D297E)
Ref Sequence ENSEMBL: ENSMUSP00000016125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect probably benign
Transcript: ENSMUST00000016125
AA Change: D297E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: D297E

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165870
AA Change: D179E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981
AA Change: D179E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,295,969 (GRCm39) Q966R probably benign Het
Amn A G 12: 111,240,590 (GRCm39) D74G possibly damaging Het
Ank2 T A 3: 126,739,120 (GRCm39) T2255S probably benign Het
Ankfy1 G A 11: 72,645,285 (GRCm39) C788Y probably benign Het
Apaf1 A G 10: 90,895,433 (GRCm39) probably null Het
Asl T A 5: 130,047,720 (GRCm39) H82L probably benign Het
Atrn A G 2: 130,788,011 (GRCm39) E271G probably benign Het
B4galnt3 A G 6: 120,201,125 (GRCm39) F184S probably damaging Het
C1s2 T A 6: 124,602,768 (GRCm39) H481L probably damaging Het
Cav2 A G 6: 17,286,918 (GRCm39) D58G possibly damaging Het
Cc2d2a A T 5: 43,866,455 (GRCm39) H755L probably benign Het
Ccdc65 A G 15: 98,606,433 (GRCm39) probably null Het
Celsr3 A T 9: 108,705,554 (GRCm39) Y679F probably damaging Het
Cep135 A T 5: 76,772,490 (GRCm39) Y625F probably benign Het
Cfhr1 A G 1: 139,478,654 (GRCm39) S58P probably damaging Het
Clip4 T A 17: 72,113,628 (GRCm39) C259* probably null Het
Cyp2j12 T A 4: 96,029,074 (GRCm39) Q69L probably damaging Het
Dock3 G A 9: 106,790,147 (GRCm39) T1484I probably benign Het
Ecscr CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 18: 35,849,813 (GRCm39) probably benign Het
Efcab3 A T 11: 104,683,383 (GRCm39) I1604F probably benign Het
Fam43b T C 4: 138,122,522 (GRCm39) D266G probably damaging Het
Fbxl13 T A 5: 21,705,498 (GRCm39) I618F possibly damaging Het
Gne C T 4: 44,053,019 (GRCm39) probably benign Het
Gnpat T A 8: 125,605,593 (GRCm39) V321E probably damaging Het
Gpatch8 G A 11: 102,378,350 (GRCm39) A200V unknown Het
Grid1 C A 14: 35,284,504 (GRCm39) A749E probably benign Het
Grip2 C T 6: 91,756,832 (GRCm39) V540I probably benign Het
Ice2 C T 9: 69,324,354 (GRCm39) T759M probably damaging Het
Jrk G T 15: 74,578,189 (GRCm39) N365K possibly damaging Het
Kank4 A G 4: 98,653,791 (GRCm39) I879T probably damaging Het
Krtap20-1 T A 16: 88,812,288 (GRCm39) Y24* probably null Het
Lao1 T A 4: 118,819,197 (GRCm39) M1K probably null Het
Mlf1 A G 3: 67,291,927 (GRCm39) R31G probably damaging Het
Nt5c3b T C 11: 100,330,974 (GRCm39) probably benign Het
Nusap1 A G 2: 119,460,902 (GRCm39) R132G probably benign Het
Or11g1 A G 14: 50,651,847 (GRCm39) Y282C probably damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or5w20 G A 2: 87,727,280 (GRCm39) V254I probably benign Het
Or8d2b A C 9: 38,788,673 (GRCm39) D67A probably damaging Het
Paqr9 G T 9: 95,442,828 (GRCm39) V273L possibly damaging Het
Pcdha9 A T 18: 37,131,984 (GRCm39) D351V probably benign Het
Pcdhga1 A G 18: 37,797,282 (GRCm39) D762G probably benign Het
Pde3a T A 6: 141,444,615 (GRCm39) L1141Q possibly damaging Het
Pga5 T A 19: 10,649,149 (GRCm39) probably null Het
Phldb3 C A 7: 24,326,127 (GRCm39) R570S probably damaging Het
Slc22a6 A C 19: 8,599,161 (GRCm39) E264A probably damaging Het
Slc49a4 C T 16: 35,525,167 (GRCm39) M426I probably benign Het
Slit1 T C 19: 41,626,034 (GRCm39) K576R probably damaging Het
Sox21 T C 14: 118,473,040 (GRCm39) K3R possibly damaging Het
Suclg1 T C 6: 73,252,326 (GRCm39) V323A probably damaging Het
Tas1r2 T G 4: 139,396,199 (GRCm39) C513G probably damaging Het
Tbc1d23 A G 16: 56,992,152 (GRCm39) Y603H probably damaging Het
Tbc1d31 T C 15: 57,816,192 (GRCm39) V642A probably damaging Het
Tle2 A T 10: 81,423,168 (GRCm39) D486V probably damaging Het
Tmem232 A G 17: 65,792,867 (GRCm39) I110T probably damaging Het
Tmem39b A G 4: 129,586,894 (GRCm39) Y106H probably damaging Het
Trpm4 T G 7: 44,976,100 (GRCm39) N229T probably damaging Het
Tspo A G 15: 83,458,007 (GRCm39) T120A probably benign Het
Ttc28 G A 5: 111,371,851 (GRCm39) A767T probably damaging Het
Usp53 G A 3: 122,727,652 (GRCm39) Q977* probably null Het
Vmn1r215 T A 13: 23,260,528 (GRCm39) D189E probably damaging Het
Vmn2r12 T C 5: 109,233,866 (GRCm39) Y782C probably benign Het
Vmn2r54 A G 7: 12,349,908 (GRCm39) L558P probably damaging Het
Zfp268 T A 4: 145,350,628 (GRCm39) C688* probably null Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1473:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1589:Stk32c UTSW 7 138,698,931 (GRCm39) critical splice donor site probably null
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R6745:Stk32c UTSW 7 138,702,809 (GRCm39) missense probably damaging 0.99
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7676:Stk32c UTSW 7 138,685,220 (GRCm39) missense possibly damaging 0.87
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9117:Stk32c UTSW 7 138,768,141 (GRCm39) missense unknown
R9481:Stk32c UTSW 7 138,768,173 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTGAGCCCATGGAAAGATG -3'
(R):5'- CCCTTGACAGATGAGCTTCTGG -3'

Sequencing Primer
(F):5'- CCATGGAAAGATGGGGTGTCTCC -3'
(R):5'- AGATGAGCTTCTGGCCTCTGATAC -3'
Posted On 2017-10-10