Incidental Mutation 'R0524:Rdh13'
ID 48777
Institutional Source Beutler Lab
Gene Symbol Rdh13
Ensembl Gene ENSMUSG00000008435
Gene Name retinol dehydrogenase 13 (all-trans and 9-cis)
Synonyms 8430425D21Rik
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R0524 (G1)
Quality Score 193
Status Not validated
Chromosome 7
Chromosomal Location 4427769-4448648 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 4447296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tryptophan at position 10 (C10W)
Ref Sequence ENSEMBL: ENSMUSP00000114390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008579] [ENSMUST00000119485] [ENSMUST00000138798]
AlphaFold Q8CEE7
Predicted Effect probably damaging
Transcript: ENSMUST00000008579
AA Change: C30W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008579
Gene: ENSMUSG00000008435
AA Change: C30W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:KR 39 204 1.3e-7 PFAM
Pfam:adh_short 39 245 1.4e-37 PFAM
Pfam:Epimerase 41 231 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104772
Predicted Effect probably damaging
Transcript: ENSMUST00000119485
AA Change: C30W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113433
Gene: ENSMUSG00000008435
AA Change: C30W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:adh_short 39 115 7.8e-10 PFAM
low complexity region 117 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128299
Predicted Effect probably damaging
Transcript: ENSMUST00000138798
AA Change: C10W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114390
Gene: ENSMUSG00000008435
AA Change: C10W

DomainStartEndE-ValueType
Pfam:KR 19 112 2.7e-7 PFAM
Pfam:adh_short 19 115 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial short-chain dehydrogenase/reductase, which catalyzes the reduction and oxidation of retinoids. The encoded enzyme may function in retinoic acid production and may also protect the mitochondria against oxidative stress. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit disintegration of the outer-plus-inner-segment and outer nuclear layers, reduced amplitudes of a- and b-waves under scotopic conditions and swollen mitochondria in the inner segment following exposure to intense light. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Rdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Rdh13 APN 7 4,445,694 (GRCm39) missense probably benign 0.00
IGL01339:Rdh13 APN 7 4,430,623 (GRCm39) missense probably damaging 1.00
IGL01778:Rdh13 APN 7 4,433,388 (GRCm39) splice site probably null
IGL02269:Rdh13 APN 7 4,448,497 (GRCm39) missense possibly damaging 0.95
IGL02749:Rdh13 APN 7 4,430,703 (GRCm39) missense probably damaging 1.00
IGL02820:Rdh13 APN 7 4,438,059 (GRCm39) missense probably damaging 1.00
R1698:Rdh13 UTSW 7 4,430,790 (GRCm39) missense probably damaging 0.97
R2111:Rdh13 UTSW 7 4,448,482 (GRCm39) missense probably benign
R2177:Rdh13 UTSW 7 4,430,666 (GRCm39) missense possibly damaging 0.80
R4811:Rdh13 UTSW 7 4,445,652 (GRCm39) missense probably benign 0.11
R7359:Rdh13 UTSW 7 4,430,696 (GRCm39) missense probably benign 0.37
R8887:Rdh13 UTSW 7 4,434,522 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGGTTCAATGTCAGGACCTAC -3'
(R):5'- AATCCTTTTCTGAGGCCATGACGAG -3'

Sequencing Primer
(F):5'- gcctttattcacttagcacaacatc -3'
(R):5'- ATGACGAGGACTCCCGTG -3'
Posted On 2013-06-12