Incidental Mutation 'R0524:Rdh13'
List |< first << previous [record 36 of 51] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Rdh13
Ensembl Gene ENSMUSG00000008435
Gene Nameretinol dehydrogenase 13 (all-trans and 9-cis)
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0524 (G1)
Quality Score193
Status Not validated
Chromosomal Location4424770-4445649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4444297 bp
Amino Acid Change Cysteine to Tryptophan at position 10 (C10W)
Ref Sequence ENSEMBL: ENSMUSP00000114390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008579] [ENSMUST00000119485] [ENSMUST00000138798]
Predicted Effect probably damaging
Transcript: ENSMUST00000008579
AA Change: C30W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008579
Gene: ENSMUSG00000008435
AA Change: C30W

signal peptide 1 16 N/A INTRINSIC
Pfam:KR 39 204 1.3e-7 PFAM
Pfam:adh_short 39 245 1.4e-37 PFAM
Pfam:Epimerase 41 231 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104772
Predicted Effect probably damaging
Transcript: ENSMUST00000119485
AA Change: C30W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113433
Gene: ENSMUSG00000008435
AA Change: C30W

signal peptide 1 16 N/A INTRINSIC
Pfam:adh_short 39 115 7.8e-10 PFAM
low complexity region 117 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128299
Predicted Effect probably damaging
Transcript: ENSMUST00000138798
AA Change: C10W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114390
Gene: ENSMUSG00000008435
AA Change: C10W

Pfam:KR 19 112 2.7e-7 PFAM
Pfam:adh_short 19 115 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial short-chain dehydrogenase/reductase, which catalyzes the reduction and oxidation of retinoids. The encoded enzyme may function in retinoic acid production and may also protect the mitochondria against oxidative stress. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit disintegration of the outer-plus-inner-segment and outer nuclear layers, reduced amplitudes of a- and b-waves under scotopic conditions and swollen mitochondria in the inner segment following exposure to intense light. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Rdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Rdh13 APN 7 4442695 missense probably benign 0.00
IGL01339:Rdh13 APN 7 4427624 missense probably damaging 1.00
IGL01778:Rdh13 APN 7 4430389 splice site probably null
IGL02269:Rdh13 APN 7 4445498 missense possibly damaging 0.95
IGL02749:Rdh13 APN 7 4427704 missense probably damaging 1.00
IGL02820:Rdh13 APN 7 4435060 missense probably damaging 1.00
R1698:Rdh13 UTSW 7 4427791 missense probably damaging 0.97
R2111:Rdh13 UTSW 7 4445483 missense probably benign
R2177:Rdh13 UTSW 7 4427667 missense possibly damaging 0.80
R4811:Rdh13 UTSW 7 4442653 missense probably benign 0.11
R7359:Rdh13 UTSW 7 4427697 missense probably benign 0.37
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcctttattcacttagcacaacatc -3'
Posted On2013-06-12