Incidental Mutation 'R6176:Olfr1'
ID487777
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 044318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6176 (G1)
Quality Score217.468
Status Validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73395654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,377,732 Q966R probably benign Het
Amn A G 12: 111,274,156 D74G possibly damaging Het
Ank2 T A 3: 126,945,471 T2255S probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Apaf1 A G 10: 91,059,571 probably null Het
Asl T A 5: 130,018,879 H82L probably benign Het
Atrn A G 2: 130,946,091 E271G probably benign Het
B4galnt3 A G 6: 120,224,164 F184S probably damaging Het
C1s2 T A 6: 124,625,809 H481L probably damaging Het
Cav2 A G 6: 17,286,919 D58G possibly damaging Het
Cc2d2a A T 5: 43,709,113 H755L probably benign Het
Ccdc65 A G 15: 98,708,552 probably null Het
Celsr3 A T 9: 108,828,355 Y679F probably damaging Het
Cep135 A T 5: 76,624,643 Y625F probably benign Het
Cfhr1 A G 1: 139,550,916 S58P probably damaging Het
Clip4 T A 17: 71,806,633 C259* probably null Het
Cyp2j12 T A 4: 96,140,837 Q69L probably damaging Het
Dirc2 C T 16: 35,704,797 M426I probably benign Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Ecscr CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 18: 35,716,760 probably benign Het
Fam43b T C 4: 138,395,211 D266G probably damaging Het
Fbxl13 T A 5: 21,500,500 I618F possibly damaging Het
Gm10229 T A 16: 89,015,400 Y24* probably null Het
Gm11639 A T 11: 104,792,557 I1604F probably benign Het
Gm13212 T A 4: 145,624,058 C688* probably null Het
Gne C T 4: 44,053,019 probably benign Het
Gnpat T A 8: 124,878,854 V321E probably damaging Het
Gpatch8 G A 11: 102,487,524 A200V unknown Het
Grid1 C A 14: 35,562,547 A749E probably benign Het
Grip2 C T 6: 91,779,851 V540I probably benign Het
Ice2 C T 9: 69,417,072 T759M probably damaging Het
Jrk G T 15: 74,706,340 N365K possibly damaging Het
Kank4 A G 4: 98,765,554 I879T probably damaging Het
Lao1 T A 4: 118,962,000 M1K probably null Het
Mlf1 A G 3: 67,384,594 R31G probably damaging Het
Nt5c3b T C 11: 100,440,148 probably benign Het
Nusap1 A G 2: 119,630,421 R132G probably benign Het
Olfr1153 G A 2: 87,896,936 V254I probably benign Het
Olfr738 A G 14: 50,414,390 Y282C probably damaging Het
Olfr926 A C 9: 38,877,377 D67A probably damaging Het
Paqr9 G T 9: 95,560,775 V273L possibly damaging Het
Pcdha9 A T 18: 36,998,931 D351V probably benign Het
Pcdhga1 A G 18: 37,664,229 D762G probably benign Het
Pde3a T A 6: 141,498,889 L1141Q possibly damaging Het
Pga5 T A 19: 10,671,785 probably null Het
Phldb3 C A 7: 24,626,702 R570S probably damaging Het
Slc22a6 A C 19: 8,621,797 E264A probably damaging Het
Slit1 T C 19: 41,637,595 K576R probably damaging Het
Sox21 T C 14: 118,235,628 K3R possibly damaging Het
Stk32c A T 7: 139,120,775 D297E probably benign Het
Suclg1 T C 6: 73,275,343 V323A probably damaging Het
Tas1r2 T G 4: 139,668,888 C513G probably damaging Het
Tbc1d23 A G 16: 57,171,789 Y603H probably damaging Het
Tbc1d31 T C 15: 57,952,796 V642A probably damaging Het
Tle2 A T 10: 81,587,334 D486V probably damaging Het
Tmem232 A G 17: 65,485,872 I110T probably damaging Het
Tmem39b A G 4: 129,693,101 Y106H probably damaging Het
Trpm4 T G 7: 45,326,676 N229T probably damaging Het
Tspo A G 15: 83,573,806 T120A probably benign Het
Ttc28 G A 5: 111,223,985 A767T probably damaging Het
Usp53 G A 3: 122,934,003 Q977* probably null Het
Vmn1r215 T A 13: 23,076,358 D189E probably damaging Het
Vmn2r12 T C 5: 109,086,000 Y782C probably benign Het
Vmn2r54 A G 7: 12,615,981 L558P probably damaging Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
R7530:Olfr1 UTSW 11 73388363 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATTAACACGGGTGTCAGAGC -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On2017-10-10