Incidental Mutation 'R0524:Vmn1r72'
ID48778
Institutional Source Beutler Lab
Gene Symbol Vmn1r72
Ensembl Gene ENSMUSG00000095430
Gene Namevomeronasal 1 receptor 72
SynonymsV1rg1
MMRRC Submission 038717-MU
Accession Numbers

Genbank: NM_145843; MGI: 2182256

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location11664479-11680147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11669792 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 243 (F243S)
Ref Sequence ENSEMBL: ENSMUSP00000154511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053134] [ENSMUST00000209638] [ENSMUST00000227010]
Predicted Effect probably benign
Transcript: ENSMUST00000053134
AA Change: F243S

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052997
Gene: ENSMUSG00000095430
AA Change: F243S

DomainStartEndE-ValueType
Pfam:TAS2R 1 305 1.8e-9 PFAM
Pfam:V1R 25 300 6.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209638
AA Change: F243S

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227010
AA Change: F243S

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Vmn1r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Vmn1r72 APN 7 11670497 missense probably benign 0.41
IGL02375:Vmn1r72 APN 7 11669745 missense probably benign 0.10
IGL02809:Vmn1r72 APN 7 11670003 missense probably benign 0.03
IGL03104:Vmn1r72 APN 7 11669885 missense probably damaging 1.00
3-1:Vmn1r72 UTSW 7 11669898 missense probably damaging 0.97
IGL03014:Vmn1r72 UTSW 7 11669784 missense possibly damaging 0.80
R0346:Vmn1r72 UTSW 7 11669694 missense probably benign
R1951:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R1953:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R2181:Vmn1r72 UTSW 7 11669668 nonsense probably null
R4182:Vmn1r72 UTSW 7 11670068 missense probably benign 0.00
R4345:Vmn1r72 UTSW 7 11670036 missense possibly damaging 0.86
R4496:Vmn1r72 UTSW 7 11669864 missense probably damaging 1.00
R4999:Vmn1r72 UTSW 7 11670373 missense possibly damaging 0.63
R5401:Vmn1r72 UTSW 7 11669916 missense probably damaging 1.00
R5700:Vmn1r72 UTSW 7 11670423 missense probably damaging 0.98
R5754:Vmn1r72 UTSW 7 11669849 missense probably damaging 0.99
R6292:Vmn1r72 UTSW 7 11669652 missense probably benign 0.02
R6439:Vmn1r72 UTSW 7 11679137 intron probably null
R7616:Vmn1r72 UTSW 7 11670345 missense probably damaging 0.96
R7629:Vmn1r72 UTSW 7 11669784 missense probably benign
X0063:Vmn1r72 UTSW 7 11669712 missense probably benign 0.00
Z1088:Vmn1r72 UTSW 7 11670173 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCCTGGAAATGGGCTTCATATTGC -3'
(R):5'- AGAGCACTTGACCTTTGCCAACTG -3'

Sequencing Primer
(F):5'- GGCTTCATATTGCTGAGAAGAAC -3'
(R):5'- TGTTAGGCCCCAGTTACAAG -3'
Posted On2013-06-12