Incidental Mutation 'R6176:Jrk'
ID487785
Institutional Source Beutler Lab
Gene Symbol Jrk
Ensembl Gene ENSMUSG00000046380
Gene Namejerky
Synonyms
MMRRC Submission 044318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6176 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location74702301-74709535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74706340 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 365 (N365K)
Ref Sequence ENSEMBL: ENSMUSP00000051842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050234
AA Change: N365K

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051842
Gene: ENSMUSG00000046380
AA Change: N365K

DomainStartEndE-ValueType
Pfam:CENP-B_N 14 66 5.3e-27 PFAM
CENPB 83 149 8.82e-24 SMART
Pfam:DDE_1 213 382 2.2e-46 PFAM
low complexity region 395 405 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056711
SMART Domains Protein: ENSMUSP00000060582
Gene: ENSMUSG00000044276

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is similar to DNA-binding proteins, such as major centromere autoantigen B (CENPB). Inactivation of the related gene in mice resulted in epileptic seizures. Childhood Absence Epilepsy (CAE) has been mapped to the same chromosomal location (8q24.3) as this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Heterozygous mutants show whole body jerks, clonic seizures and epileptic brain activity. Homozygous mutants show elevated seizure susceptibility, impaired postnatal growth, reduced life span, male sterility and impaired female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,377,732 Q966R probably benign Het
Amn A G 12: 111,274,156 D74G possibly damaging Het
Ank2 T A 3: 126,945,471 T2255S probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Apaf1 A G 10: 91,059,571 probably null Het
Asl T A 5: 130,018,879 H82L probably benign Het
Atrn A G 2: 130,946,091 E271G probably benign Het
B4galnt3 A G 6: 120,224,164 F184S probably damaging Het
C1s2 T A 6: 124,625,809 H481L probably damaging Het
Cav2 A G 6: 17,286,919 D58G possibly damaging Het
Cc2d2a A T 5: 43,709,113 H755L probably benign Het
Ccdc65 A G 15: 98,708,552 probably null Het
Celsr3 A T 9: 108,828,355 Y679F probably damaging Het
Cep135 A T 5: 76,624,643 Y625F probably benign Het
Cfhr1 A G 1: 139,550,916 S58P probably damaging Het
Clip4 T A 17: 71,806,633 C259* probably null Het
Cyp2j12 T A 4: 96,140,837 Q69L probably damaging Het
Dirc2 C T 16: 35,704,797 M426I probably benign Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Ecscr CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 18: 35,716,760 probably benign Het
Fam43b T C 4: 138,395,211 D266G probably damaging Het
Fbxl13 T A 5: 21,500,500 I618F possibly damaging Het
Gm10229 T A 16: 89,015,400 Y24* probably null Het
Gm11639 A T 11: 104,792,557 I1604F probably benign Het
Gm13212 T A 4: 145,624,058 C688* probably null Het
Gne C T 4: 44,053,019 probably benign Het
Gnpat T A 8: 124,878,854 V321E probably damaging Het
Gpatch8 G A 11: 102,487,524 A200V unknown Het
Grid1 C A 14: 35,562,547 A749E probably benign Het
Grip2 C T 6: 91,779,851 V540I probably benign Het
Ice2 C T 9: 69,417,072 T759M probably damaging Het
Kank4 A G 4: 98,765,554 I879T probably damaging Het
Lao1 T A 4: 118,962,000 M1K probably null Het
Mlf1 A G 3: 67,384,594 R31G probably damaging Het
Nt5c3b T C 11: 100,440,148 probably benign Het
Nusap1 A G 2: 119,630,421 R132G probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1153 G A 2: 87,896,936 V254I probably benign Het
Olfr738 A G 14: 50,414,390 Y282C probably damaging Het
Olfr926 A C 9: 38,877,377 D67A probably damaging Het
Paqr9 G T 9: 95,560,775 V273L possibly damaging Het
Pcdha9 A T 18: 36,998,931 D351V probably benign Het
Pcdhga1 A G 18: 37,664,229 D762G probably benign Het
Pde3a T A 6: 141,498,889 L1141Q possibly damaging Het
Pga5 T A 19: 10,671,785 probably null Het
Phldb3 C A 7: 24,626,702 R570S probably damaging Het
Slc22a6 A C 19: 8,621,797 E264A probably damaging Het
Slit1 T C 19: 41,637,595 K576R probably damaging Het
Sox21 T C 14: 118,235,628 K3R possibly damaging Het
Stk32c A T 7: 139,120,775 D297E probably benign Het
Suclg1 T C 6: 73,275,343 V323A probably damaging Het
Tas1r2 T G 4: 139,668,888 C513G probably damaging Het
Tbc1d23 A G 16: 57,171,789 Y603H probably damaging Het
Tbc1d31 T C 15: 57,952,796 V642A probably damaging Het
Tle2 A T 10: 81,587,334 D486V probably damaging Het
Tmem232 A G 17: 65,485,872 I110T probably damaging Het
Tmem39b A G 4: 129,693,101 Y106H probably damaging Het
Trpm4 T G 7: 45,326,676 N229T probably damaging Het
Tspo A G 15: 83,573,806 T120A probably benign Het
Ttc28 G A 5: 111,223,985 A767T probably damaging Het
Usp53 G A 3: 122,934,003 Q977* probably null Het
Vmn1r215 T A 13: 23,076,358 D189E probably damaging Het
Vmn2r12 T C 5: 109,086,000 Y782C probably benign Het
Vmn2r54 A G 7: 12,615,981 L558P probably damaging Het
Other mutations in Jrk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Jrk UTSW 15 74706156 missense probably benign 0.01
R1871:Jrk UTSW 15 74706563 missense possibly damaging 0.91
R3417:Jrk UTSW 15 74706885 missense probably damaging 0.96
R4867:Jrk UTSW 15 74707220 missense probably benign 0.00
R5294:Jrk UTSW 15 74707336 missense possibly damaging 0.88
R5769:Jrk UTSW 15 74706068 missense probably benign 0.19
R5911:Jrk UTSW 15 74705768 missense possibly damaging 0.88
R6123:Jrk UTSW 15 74706680 missense possibly damaging 0.46
R7411:Jrk UTSW 15 74707199 missense possibly damaging 0.47
R7480:Jrk UTSW 15 74707053 missense probably benign 0.16
Z1088:Jrk UTSW 15 74707394 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGGGATGGTGCCACAATGG -3'
(R):5'- CAGGGTAATGCCTGGGTAGAC -3'

Sequencing Primer
(F):5'- GAACAGGTTGGCCCTTCTTTTACAAG -3'
(R):5'- GACAGCAAGGCAATTCTCTTG -3'
Posted On2017-10-10