Incidental Mutation 'R6177:Rc3h2'
ID487801
Institutional Source Beutler Lab
Gene Symbol Rc3h2
Ensembl Gene ENSMUSG00000075376
Gene Namering finger and CCCH-type zinc finger domains 2
SynonymsMnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37370069-37422903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37389646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 524 (V524I)
Ref Sequence ENSEMBL: ENSMUSP00000108558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]
Predicted Effect probably benign
Transcript: ENSMUST00000100143
AA Change: V524I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: V524I

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112934
AA Change: V524I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: V524I

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112936
AA Change: V524I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: V524I

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125619
SMART Domains Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376

DomainStartEndE-ValueType
RING 14 53 1.4e-7 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 6.9e-6 SMART
low complexity region 455 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205124
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Rc3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Rc3h2 APN 2 37389747 missense possibly damaging 0.59
IGL00944:Rc3h2 APN 2 37398238 splice site probably benign
IGL01065:Rc3h2 APN 2 37377844 splice site probably benign
IGL01966:Rc3h2 APN 2 37382777 splice site probably benign
IGL02123:Rc3h2 APN 2 37398253 missense probably damaging 1.00
IGL02174:Rc3h2 APN 2 37411225 missense probably benign 0.11
IGL02448:Rc3h2 APN 2 37389805 missense probably benign 0.08
IGL02539:Rc3h2 APN 2 37389715 missense probably benign 0.09
IGL02698:Rc3h2 APN 2 37405300 missense probably damaging 0.99
IGL02731:Rc3h2 APN 2 37382811 missense probably benign 0.00
IGL02958:Rc3h2 APN 2 37414700 missense probably damaging 1.00
IGL02959:Rc3h2 APN 2 37405354 missense probably damaging 1.00
PIT4468001:Rc3h2 UTSW 2 37399639 missense probably damaging 1.00
R0309:Rc3h2 UTSW 2 37379008 splice site probably benign
R0488:Rc3h2 UTSW 2 37389588 missense probably damaging 0.99
R0506:Rc3h2 UTSW 2 37376659 critical splice donor site probably null
R0612:Rc3h2 UTSW 2 37411215 missense possibly damaging 0.77
R0628:Rc3h2 UTSW 2 37382052 splice site probably benign
R0647:Rc3h2 UTSW 2 37409530 missense probably damaging 1.00
R0680:Rc3h2 UTSW 2 37399835 missense probably damaging 0.97
R0738:Rc3h2 UTSW 2 37405374 missense probably damaging 1.00
R2005:Rc3h2 UTSW 2 37389753 nonsense probably null
R2105:Rc3h2 UTSW 2 37399624 missense possibly damaging 0.89
R2133:Rc3h2 UTSW 2 37378916 missense probably benign 0.12
R2373:Rc3h2 UTSW 2 37379001 missense possibly damaging 0.94
R2414:Rc3h2 UTSW 2 37399819 critical splice donor site probably null
R2850:Rc3h2 UTSW 2 37377415 missense probably benign
R2913:Rc3h2 UTSW 2 37378959 missense possibly damaging 0.89
R2932:Rc3h2 UTSW 2 37378359 missense probably benign 0.10
R4441:Rc3h2 UTSW 2 37414514 critical splice donor site probably null
R4932:Rc3h2 UTSW 2 37389832 missense possibly damaging 0.77
R5114:Rc3h2 UTSW 2 37398361 splice site probably null
R5169:Rc3h2 UTSW 2 37405312 missense probably damaging 1.00
R5360:Rc3h2 UTSW 2 37389855 missense possibly damaging 0.59
R5477:Rc3h2 UTSW 2 37399630 missense possibly damaging 0.94
R5553:Rc3h2 UTSW 2 37398311 nonsense probably null
R5776:Rc3h2 UTSW 2 37378313 missense possibly damaging 0.59
R5842:Rc3h2 UTSW 2 37378371 missense possibly damaging 0.77
R5935:Rc3h2 UTSW 2 37414733 frame shift probably null
R6060:Rc3h2 UTSW 2 37399600 missense possibly damaging 0.77
R6112:Rc3h2 UTSW 2 37378887 missense possibly damaging 0.59
R6172:Rc3h2 UTSW 2 37414733 frame shift probably null
R6173:Rc3h2 UTSW 2 37414733 frame shift probably null
R6455:Rc3h2 UTSW 2 37409470 missense probably damaging 1.00
R6457:Rc3h2 UTSW 2 37411139 critical splice donor site probably null
R6467:Rc3h2 UTSW 2 37382016 missense probably damaging 0.97
R6647:Rc3h2 UTSW 2 37382944 nonsense probably null
R6694:Rc3h2 UTSW 2 37400543 missense probably damaging 1.00
R6695:Rc3h2 UTSW 2 37414661 missense possibly damaging 0.88
R7054:Rc3h2 UTSW 2 37375246 missense probably benign 0.07
R7159:Rc3h2 UTSW 2 37409647 missense probably benign 0.39
R7162:Rc3h2 UTSW 2 37409605 missense possibly damaging 0.59
R7640:Rc3h2 UTSW 2 37377849 critical splice donor site probably null
R7676:Rc3h2 UTSW 2 37405332 missense possibly damaging 0.95
R8209:Rc3h2 UTSW 2 37376989 missense possibly damaging 0.77
R8226:Rc3h2 UTSW 2 37376989 missense possibly damaging 0.77
X0013:Rc3h2 UTSW 2 37389786 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCTGCCTTGTGAGGATTAGAAC -3'
(R):5'- GTGTAAACAGCACTGTCACAAC -3'

Sequencing Primer
(F):5'- TGAGGATTAGAACTCAAATTTTGTGG -3'
(R):5'- CCACAGCCGGAAATGTCATTTC -3'
Posted On2017-10-10