Incidental Mutation 'R6177:Olfr1015'
ID487805
Institutional Source Beutler Lab
Gene Symbol Olfr1015
Ensembl Gene ENSMUSG00000033850
Gene Nameolfactory receptor 1015
SynonymsGA_x6K02T2Q125-47264151-47265089, MOR213-3
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85782017-85787812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85785660 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 50 (R50C)
Ref Sequence ENSEMBL: ENSMUSP00000148957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047870] [ENSMUST00000215945]
Predicted Effect probably damaging
Transcript: ENSMUST00000047870
AA Change: R50C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046301
Gene: ENSMUSG00000033850
AA Change: R50C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.5e-49 PFAM
Pfam:7tm_1 41 290 4.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214726
Predicted Effect probably damaging
Transcript: ENSMUST00000215945
AA Change: R50C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Olfr1015
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Olfr1015 APN 2 85786117 missense probably benign 0.21
IGL01716:Olfr1015 APN 2 85786143 missense probably damaging 0.97
IGL03196:Olfr1015 APN 2 85786021 missense possibly damaging 0.63
IGL03374:Olfr1015 APN 2 85785709 missense probably damaging 1.00
R0329:Olfr1015 UTSW 2 85785803 nonsense probably null
R0330:Olfr1015 UTSW 2 85785803 nonsense probably null
R0714:Olfr1015 UTSW 2 85786399 missense probably damaging 1.00
R0965:Olfr1015 UTSW 2 85786299 missense probably damaging 1.00
R1078:Olfr1015 UTSW 2 85786093 missense possibly damaging 0.53
R3826:Olfr1015 UTSW 2 85786215 nonsense probably null
R5031:Olfr1015 UTSW 2 85785718 nonsense probably null
R5239:Olfr1015 UTSW 2 85785658 missense probably damaging 1.00
R6120:Olfr1015 UTSW 2 85786341 missense probably damaging 1.00
R6726:Olfr1015 UTSW 2 85785562 missense possibly damaging 0.51
R6954:Olfr1015 UTSW 2 85786382 nonsense probably null
R7766:Olfr1015 UTSW 2 85785658 missense probably damaging 1.00
R8193:Olfr1015 UTSW 2 85785961 missense probably benign 0.34
R8245:Olfr1015 UTSW 2 85785775 missense probably benign 0.02
Z1176:Olfr1015 UTSW 2 85786120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACATCATGTTATTCAGGTCCAG -3'
(R):5'- TAGCACTCAGTGTAGGCTGC -3'

Sequencing Primer
(F):5'- TCATGTTATTCAGGTCCAGTATTTG -3'
(R):5'- CTGCTACACAGGAAAAGAAAAACTG -3'
Posted On2017-10-10