Incidental Mutation 'R6177:Cat'
ID487807
Institutional Source Beutler Lab
Gene Symbol Cat
Ensembl Gene ENSMUSG00000027187
Gene Namecatalase
SynonymsCas1, Cas-1, Cs-1
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103453849-103485160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103473075 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 119 (E119G)
Ref Sequence ENSEMBL: ENSMUSP00000028610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028610] [ENSMUST00000111168]
Predicted Effect probably damaging
Transcript: ENSMUST00000028610
AA Change: E119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187
AA Change: E119G

DomainStartEndE-ValueType
Catalase 28 413 4.7e-285 SMART
Pfam:Catalase-rel 434 497 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111168
SMART Domains Protein: ENSMUSP00000106798
Gene: ENSMUSG00000027187

DomainStartEndE-ValueType
Catalase 28 176 2.33e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype although subtle abnormalities do occur in mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Cat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02989:Cat APN 2 103472973 missense probably damaging 1.00
PIT4696001:Cat UTSW 2 103471812 missense probably damaging 0.99
R1968:Cat UTSW 2 103484989 missense probably benign 0.01
R2103:Cat UTSW 2 103463315 missense probably damaging 1.00
R2655:Cat UTSW 2 103471846 missense probably damaging 1.00
R3037:Cat UTSW 2 103467777 missense probably benign 0.07
R5287:Cat UTSW 2 103474360 missense probably damaging 1.00
R5527:Cat UTSW 2 103472973 missense probably damaging 1.00
R5694:Cat UTSW 2 103472994 missense probably damaging 1.00
R6089:Cat UTSW 2 103472951 missense probably null 0.48
R6281:Cat UTSW 2 103471769 missense probably damaging 1.00
R6294:Cat UTSW 2 103460295 missense probably benign
R7058:Cat UTSW 2 103474353 missense probably benign 0.31
R7274:Cat UTSW 2 103476890 missense probably benign 0.07
R7347:Cat UTSW 2 103463298 missense probably benign
R7654:Cat UTSW 2 103460364 missense probably damaging 1.00
R7762:Cat UTSW 2 103456858 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCAGGGCTTATCCTCAAATG -3'
(R):5'- GCATATTGAAGATAGCAGGTGC -3'

Sequencing Primer
(F):5'- GGGCTTATCCTCAAATGCCAATC -3'
(R):5'- GGCTGTAATATACTTGGCTATGTTCC -3'
Posted On2017-10-10