Incidental Mutation 'R6177:Gstcd'
ID487811
Institutional Source Beutler Lab
Gene Symbol Gstcd
Ensembl Gene ENSMUSG00000028018
Gene Nameglutathione S-transferase, C-terminal domain containing
Synonyms
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location132981752-133092033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133082073 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000079421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029651] [ENSMUST00000080583]
Predicted Effect probably damaging
Transcript: ENSMUST00000029651
AA Change: D288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029651
Gene: ENSMUSG00000028018
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 417 515 9e-9 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:MTS 430 508 5.3e-6 PFAM
Pfam:Methyltransf_31 440 571 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080583
AA Change: D288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079421
Gene: ENSMUSG00000028018
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 418 516 1.5e-8 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:Methyltransf_31 440 569 2.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197381
Meta Mutation Damage Score 0.9617 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Gstcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Gstcd APN 3 132986414 missense probably damaging 0.96
IGL01800:Gstcd APN 3 133084574 critical splice donor site probably null
IGL02434:Gstcd APN 3 132996202 splice site probably benign
IGL02720:Gstcd APN 3 133071961 missense probably benign 0.00
R0367:Gstcd UTSW 3 132986377 splice site probably benign
R0378:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0382:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0465:Gstcd UTSW 3 132983144 missense probably benign 0.04
R1295:Gstcd UTSW 3 133005628 missense probably damaging 1.00
R1861:Gstcd UTSW 3 132983107 missense probably damaging 1.00
R2056:Gstcd UTSW 3 133082053 missense probably benign 0.00
R2331:Gstcd UTSW 3 132998880 missense probably damaging 0.98
R2513:Gstcd UTSW 3 133082320 missense possibly damaging 0.59
R2513:Gstcd UTSW 3 133082321 missense possibly damaging 0.87
R3547:Gstcd UTSW 3 133084838 missense possibly damaging 0.86
R4022:Gstcd UTSW 3 133082068 missense probably damaging 1.00
R4713:Gstcd UTSW 3 132983099 missense probably damaging 1.00
R4877:Gstcd UTSW 3 133005553 splice site probably benign
R5152:Gstcd UTSW 3 133084956 missense possibly damaging 0.95
R5165:Gstcd UTSW 3 133084679 missense probably damaging 0.99
R6106:Gstcd UTSW 3 132998914 missense probably benign 0.02
R7100:Gstcd UTSW 3 133084943 missense probably benign 0.01
R7264:Gstcd UTSW 3 133084779 missense probably benign 0.00
R7785:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R7786:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R8029:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R8036:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R8088:Gstcd UTSW 3 133082107 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCTTTACACTGATCCCACTATAGAG -3'
(R):5'- AAAGACTTGGCTGCTCCCTC -3'

Sequencing Primer
(F):5'- AGTTCCAGAGACTTCAGTCCATGG -3'
(R):5'- TCCCTCCAAGAGTCTGGAACTG -3'
Posted On2017-10-10