Incidental Mutation 'R6177:Cdk5rap2'
ID 487812
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 044319-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R6177 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70199719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 802 (R802C)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably damaging
Transcript: ENSMUST00000144099
AA Change: R802C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: R802C

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,074,896 (GRCm39) I306V probably damaging Het
Actrt3 A T 3: 30,652,316 (GRCm39) Y259* probably null Het
Ankfy1 G A 11: 72,645,285 (GRCm39) C788Y probably benign Het
Ano1 T A 7: 144,232,478 (GRCm39) M25L possibly damaging Het
Apol10b A T 15: 77,469,987 (GRCm39) D63E possibly damaging Het
Atp6v1c1 C A 15: 38,674,172 (GRCm39) S55* probably null Het
C1s2 T G 6: 124,606,960 (GRCm39) D296A probably damaging Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Cadm4 G A 7: 24,202,186 (GRCm39) V342M possibly damaging Het
Cat T C 2: 103,303,420 (GRCm39) E119G probably damaging Het
Cavin2 G T 1: 51,328,654 (GRCm39) S37I probably damaging Het
Cdhr18 T C 14: 13,868,002 (GRCm38) D229G probably benign Het
Clip1 A G 5: 123,751,897 (GRCm39) probably benign Het
Dhx57 T C 17: 80,580,395 (GRCm39) N519S possibly damaging Het
Dpep2 T C 8: 106,712,831 (GRCm39) D260G probably damaging Het
Edem1 T A 6: 108,828,159 (GRCm39) probably null Het
Epb41l4a A T 18: 33,931,868 (GRCm39) probably null Het
Esp1 T C 17: 41,039,723 (GRCm39) S3P possibly damaging Het
Fam111a A G 19: 12,564,746 (GRCm39) Y165C probably damaging Het
Fstl4 A G 11: 53,059,031 (GRCm39) T497A probably benign Het
Gstcd T C 3: 132,787,834 (GRCm39) D288G probably damaging Het
Hmcn2 T A 2: 31,310,118 (GRCm39) L3264* probably null Het
Hyal4 T A 6: 24,766,089 (GRCm39) L481* probably null Het
Ighv2-7 A G 12: 113,771,055 (GRCm39) Y77H possibly damaging Het
Jdp2 G T 12: 85,685,614 (GRCm39) R125L probably benign Het
Lrp1b A T 2: 41,013,748 (GRCm39) probably null Het
Lrp2 AC A 2: 69,340,763 (GRCm39) probably null Het
Marveld2 C T 13: 100,733,886 (GRCm39) D250N probably damaging Het
Mast3 A G 8: 71,242,662 (GRCm39) S53P probably damaging Het
Ms4a20 A G 19: 11,083,114 (GRCm39) I102T possibly damaging Het
Myo3b T C 2: 70,143,707 (GRCm39) V1041A probably benign Het
Nkpd1 T A 7: 19,257,009 (GRCm39) F113I probably damaging Het
Obscn A G 11: 58,923,490 (GRCm39) S6470P probably damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or4a73 T C 2: 89,420,661 (GRCm39) D266G possibly damaging Het
Or9g4b C T 2: 85,616,004 (GRCm39) R50C probably damaging Het
Pdcd11 G T 19: 47,108,722 (GRCm39) G1246V probably damaging Het
Phc3 A T 3: 30,996,714 (GRCm39) S219T probably damaging Het
Plxnb1 C T 9: 108,931,993 (GRCm39) probably null Het
Polh T C 17: 46,495,670 (GRCm39) D276G possibly damaging Het
Polq T A 16: 36,892,071 (GRCm39) V1991E probably damaging Het
Polr2g G A 19: 8,771,541 (GRCm39) R144C probably damaging Het
Pramel16 G A 4: 143,675,576 (GRCm39) H417Y possibly damaging Het
Prex2 A C 1: 11,207,001 (GRCm39) T520P possibly damaging Het
Psg21 T A 7: 18,386,279 (GRCm39) T236S possibly damaging Het
Ptpru A T 4: 131,520,836 (GRCm39) S761R probably benign Het
Rapgef6 G A 11: 54,510,842 (GRCm39) R253Q probably damaging Het
Rc3h2 C T 2: 37,279,658 (GRCm39) V524I probably benign Het
Sde2 T C 1: 180,685,784 (GRCm39) V112A probably damaging Het
Septin7 T C 9: 25,205,100 (GRCm39) probably null Het
Spef2 A G 15: 9,727,618 (GRCm39) V155A possibly damaging Het
St7 T C 6: 17,819,333 (GRCm39) probably null Het
Tmcc3 A T 10: 94,418,249 (GRCm39) Y339F probably damaging Het
Tmed6 T C 8: 107,792,083 (GRCm39) E54G probably damaging Het
Tnks1bp1 C T 2: 84,889,624 (GRCm39) probably benign Het
Trim43c T C 9: 88,722,600 (GRCm39) L82P possibly damaging Het
Txndc2 T C 17: 65,945,466 (GRCm39) D237G probably benign Het
Vmn1r91 T A 7: 19,835,404 (GRCm39) C108S possibly damaging Het
Vtn A T 11: 78,390,836 (GRCm39) D165V probably damaging Het
Wdr3 A T 3: 100,068,468 (GRCm39) S13R probably damaging Het
Zdhhc16 A G 19: 41,926,198 (GRCm39) Y31C probably benign Het
Zfp39 A T 11: 58,781,887 (GRCm39) W292R probably benign Het
Zfp612 A T 8: 110,816,606 (GRCm39) L604F probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGGTCTGCACTGAAACAC -3'
(R):5'- ACTCAACAGGCAGTTTGTGAG -3'

Sequencing Primer
(F):5'- ATGGTCTGCACTGAAACACTCTTC -3'
(R):5'- CTCAACAGGCAGTTTGTGAGATTGC -3'
Posted On 2017-10-10