Incidental Mutation 'R6177:C1s2'
List |< first << previous [record 8 of 64] next >> last >|
ID487819
Institutional Source Beutler Lab
Gene Symbol C1s2
Ensembl Gene ENSMUSG00000079343
Gene Namecomplement component 1, s subcomponent 2
SynonymsGm5077
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124624625-124636085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 124630001 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 296 (D296A)
Ref Sequence ENSEMBL: ENSMUSP00000151642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068797] [ENSMUST00000218020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068797
AA Change: D290A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066999
Gene: ENSMUSG00000079343
AA Change: D290A

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204754
AA Change: D296A
SMART Domains Protein: ENSMUSP00000145029
Gene: ENSMUSG00000107554
AA Change: D296A

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218020
AA Change: D296A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in C1s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:C1s2 APN 6 124625653 missense probably damaging 0.99
IGL02112:C1s2 APN 6 124625308 missense probably benign 0.28
IGL02342:C1s2 APN 6 124632116 missense probably damaging 0.98
R0616:C1s2 UTSW 6 124628764 missense probably damaging 1.00
R0621:C1s2 UTSW 6 124631112 missense probably damaging 1.00
R1439:C1s2 UTSW 6 124630167 splice site probably benign
R1451:C1s2 UTSW 6 124625494 missense probably benign 0.06
R1484:C1s2 UTSW 6 124625645 missense possibly damaging 0.95
R1570:C1s2 UTSW 6 124625764 missense probably benign 0.01
R1824:C1s2 UTSW 6 124635682 missense probably benign 0.03
R2009:C1s2 UTSW 6 124635089 missense probably damaging 1.00
R2109:C1s2 UTSW 6 124635045 missense probably damaging 0.96
R2197:C1s2 UTSW 6 124632110 missense probably damaging 1.00
R4421:C1s2 UTSW 6 124625215 missense probably benign 0.39
R4573:C1s2 UTSW 6 124628243 intron probably null
R4906:C1s2 UTSW 6 124635114 nonsense probably null
R4923:C1s2 UTSW 6 124625690 missense probably benign 0.00
R4977:C1s2 UTSW 6 124635639 missense probably damaging 0.96
R5030:C1s2 UTSW 6 124635588 missense possibly damaging 0.77
R5690:C1s2 UTSW 6 124631037 missense probably benign 0.13
R5708:C1s2 UTSW 6 124625743 nonsense probably null
R5846:C1s2 UTSW 6 124631164 missense probably damaging 1.00
R6176:C1s2 UTSW 6 124625809 missense probably damaging 1.00
R6842:C1s2 UTSW 6 124627502 missense probably benign 0.12
R7291:C1s2 UTSW 6 124625384 missense probably benign 0.16
R7590:C1s2 UTSW 6 124632128 missense probably damaging 1.00
R7721:C1s2 UTSW 6 124630058 missense possibly damaging 0.73
R7864:C1s2 UTSW 6 124625287 missense probably benign 0.18
R7886:C1s2 UTSW 6 124628330 missense possibly damaging 0.95
X0062:C1s2 UTSW 6 124635090 missense probably damaging 1.00
Z1177:C1s2 UTSW 6 124625734 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAACTTGTAAAAGGATATGATGCC -3'
(R):5'- AGGACACTCACTTCATACTGTATCC -3'

Sequencing Primer
(F):5'- AAAGGATATGATGCCACACATTG -3'
(R):5'- TCCTGGACCGCTAACTAT -3'
Posted On2017-10-10