Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Nsd3'

48782

Institutional Source

Beutler Lab

Gene Symbol

Nsd3

Ensembl Gene

ENSMUSG00000054823

Gene Name

nuclear receptor binding SET domain protein 3

Synonyms

Whsc1l1, WHISTLE

MMRRC Submission

038717-MU

Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Essential gene?

Possibly non essential (E-score: 0.436) question?

Stock #

R0524 (G1)

Quality Score

174

Status

Not validated

Chromosome

Chromosomal Location

25601601-25719667 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 25700577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1130 (Q1130K)

Ref Sequence

ENSEMBL: ENSMUSP00000117778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000153597]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084026
AA Change: Q1130K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: Q1130K

Domain	Start	End	E-Value	Type
low complexity region	128	151	N/A	INTRINSIC
low complexity region	193	225	N/A	INTRINSIC
PWWP	278	341	1.6e-12	SMART
low complexity region	680	701	N/A	INTRINSIC
PHD	713	756	4.49e-7	SMART
PHD	761	808	5.82e-1	SMART
PHD	809	861	3.06e0	SMART
PHD	874	963	1e-4	SMART
PWWP	968	1030	8.62e-18	SMART
AWS	1103	1154	2.61e-17	SMART
SET	1155	1278	2.17e-41	SMART
PostSET	1279	1295	2.63e-3	SMART
low complexity region	1309	1326	N/A	INTRINSIC
PHD	1332	1375	4.32e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129959

Predicted Effect

possibly damaging
Transcript: ENSMUST00000139966
AA Change: Q1081K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: Q1081K

Domain	Start	End	E-Value	Type
low complexity region	128	151	N/A	INTRINSIC
low complexity region	193	225	N/A	INTRINSIC
PWWP	278	341	1.6e-12	SMART
low complexity region	680	701	N/A	INTRINSIC
PHD	713	756	4.49e-7	SMART
PHD	761	808	5.82e-1	SMART
PHD	809	861	3.06e0	SMART
PHD	874	914	5.24e-8	SMART
PWWP	919	981	8.62e-18	SMART
AWS	1054	1105	2.61e-17	SMART
SET	1106	1229	2.17e-41	SMART
PostSET	1230	1246	2.63e-3	SMART
low complexity region	1260	1277	N/A	INTRINSIC
PHD	1283	1326	4.32e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142395
AA Change: Q1130K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: Q1130K

Domain	Start	End	E-Value	Type
low complexity region	128	151	N/A	INTRINSIC
low complexity region	193	225	N/A	INTRINSIC
PWWP	278	341	1.6e-12	SMART
low complexity region	680	701	N/A	INTRINSIC
PHD	713	756	4.49e-7	SMART
PHD	761	808	5.82e-1	SMART
PHD	809	861	3.06e0	SMART
PHD	874	963	1e-4	SMART
PWWP	968	1030	8.62e-18	SMART
AWS	1103	1154	2.61e-17	SMART
SET	1155	1278	2.17e-41	SMART
PostSET	1279	1295	2.63e-3	SMART
low complexity region	1309	1326	N/A	INTRINSIC
PHD	1332	1375	4.32e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147935

Predicted Effect

probably benign
Transcript: ENSMUST00000153597
AA Change: Q179K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000123028
Gene: ENSMUSG00000054823
AA Change: Q179K

Domain	Start	End	E-Value	Type
PWWP	17	79	8.62e-18	SMART
AWS	152	203	2.61e-17	SMART
SET	204	327	2.17e-41	SMART
PostSET	328	344	2.63e-3	SMART
low complexity region	358	375	N/A	INTRINSIC
PHD	381	424	4.32e-9	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Nsd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Nsd3	APN	8	25676712	missense	probably benign	0.40
IGL00718:Nsd3	APN	8	25706534	missense	probably damaging	0.97
IGL00727:Nsd3	APN	8	25641158	missense	probably damaging	1.00
IGL01324:Nsd3	APN	8	25662820	missense	probably damaging	1.00
IGL01614:Nsd3	APN	8	25666079	missense	possibly damaging	0.65
IGL01834:Nsd3	APN	8	25640652	missense	probably damaging	1.00
IGL02066:Nsd3	APN	8	25713488	missense	probably damaging	1.00
IGL02229:Nsd3	APN	8	25710748	missense	probably damaging	0.98
IGL02481:Nsd3	APN	8	25691116	missense	probably damaging	1.00
IGL02686:Nsd3	APN	8	25666070	missense	probably damaging	0.96
IGL03394:Nsd3	APN	8	25675749	splice site	probably benign
Pine	UTSW	8	25679936	missense	possibly damaging	0.87
D3080:Nsd3	UTSW	8	25713545	missense	possibly damaging	0.77
IGL02802:Nsd3	UTSW	8	25640906	missense	probably damaging	1.00
R0136:Nsd3	UTSW	8	25659854	nonsense	probably null
R0195:Nsd3	UTSW	8	25680693	missense	probably damaging	1.00
R0207:Nsd3	UTSW	8	25683257	missense	probably benign	0.02
R0471:Nsd3	UTSW	8	25648434	splice site	probably benign
R0511:Nsd3	UTSW	8	25678716	missense	possibly damaging	0.81
R0581:Nsd3	UTSW	8	25710691	missense	probably damaging	1.00
R0589:Nsd3	UTSW	8	25641287	missense	probably damaging	1.00
R0645:Nsd3	UTSW	8	25709069	missense	probably benign	0.08
R0664:Nsd3	UTSW	8	25714240	missense	probably damaging	0.97
R0738:Nsd3	UTSW	8	25678709	splice site	probably null
R1148:Nsd3	UTSW	8	25713380	missense	probably benign	0.09
R1148:Nsd3	UTSW	8	25713380	missense	probably benign	0.09
R1265:Nsd3	UTSW	8	25682562	missense	probably benign
R1298:Nsd3	UTSW	8	25679936	missense	possibly damaging	0.87
R1424:Nsd3	UTSW	8	25700566	missense	probably damaging	1.00
R1493:Nsd3	UTSW	8	25713380	missense	probably benign	0.09
R1528:Nsd3	UTSW	8	25698767	missense	probably damaging	1.00
R2051:Nsd3	UTSW	8	25691089	missense	probably damaging	0.99
R2199:Nsd3	UTSW	8	25666057	missense	probably damaging	0.99
R3414:Nsd3	UTSW	8	25700019	missense	probably damaging	1.00
R3522:Nsd3	UTSW	8	25706614	missense	probably benign
R3623:Nsd3	UTSW	8	25662819	missense	probably damaging	0.98
R3624:Nsd3	UTSW	8	25662819	missense	probably damaging	0.98
R3798:Nsd3	UTSW	8	25698845	missense	probably damaging	1.00
R4345:Nsd3	UTSW	8	25641317	missense	probably benign	0.04
R4370:Nsd3	UTSW	8	25648508	missense	probably benign	0.13
R4421:Nsd3	UTSW	8	25641272	missense	probably damaging	0.99
R4583:Nsd3	UTSW	8	25710676	missense	probably benign	0.20
R4664:Nsd3	UTSW	8	25698866	missense	probably damaging	1.00
R4741:Nsd3	UTSW	8	25673366	missense	probably damaging	1.00
R4876:Nsd3	UTSW	8	25691134	missense	possibly damaging	0.94
R4888:Nsd3	UTSW	8	25698911	missense	probably damaging	1.00
R5000:Nsd3	UTSW	8	25682577	missense	probably damaging	1.00
R5132:Nsd3	UTSW	8	25678839	missense	possibly damaging	0.73
R5632:Nsd3	UTSW	8	25679969	missense	probably benign	0.00
R5760:Nsd3	UTSW	8	25659756	missense	probably damaging	1.00
R5778:Nsd3	UTSW	8	25659818	missense	probably damaging	1.00
R5779:Nsd3	UTSW	8	25682669	nonsense	probably null
R5860:Nsd3	UTSW	8	25666091	missense	probably damaging	0.98
R5911:Nsd3	UTSW	8	25666076	missense	probably damaging	1.00
R6168:Nsd3	UTSW	8	25691161	missense	probably null	1.00
R6467:Nsd3	UTSW	8	25640630	missense	probably damaging	1.00
R6490:Nsd3	UTSW	8	25714185	missense	probably damaging	1.00
R6519:Nsd3	UTSW	8	25662939	missense	probably damaging	1.00
R6554:Nsd3	UTSW	8	25662875	missense	probably damaging	0.99
R7038:Nsd3	UTSW	8	25641263	missense	probably damaging	1.00
R7088:Nsd3	UTSW	8	25666034	missense	probably benign	0.40
R7244:Nsd3	UTSW	8	25666039	missense	probably damaging	0.96
R7308:Nsd3	UTSW	8	25640724	missense	probably damaging	1.00
R7678:Nsd3	UTSW	8	25659817	missense	possibly damaging	0.82
R7717:Nsd3	UTSW	8	25682562	missense	probably benign
R8064:Nsd3	UTSW	8	25700670	nonsense	probably null
R8242:Nsd3	UTSW	8	25706539	nonsense	probably null
R8312:Nsd3	UTSW	8	25663252	missense	probably damaging	1.00
R8547:Nsd3	UTSW	8	25694784	missense	probably damaging	1.00
R8954:Nsd3	UTSW	8	25673378	missense	probably damaging	1.00
R8995:Nsd3	UTSW	8	25641153	missense	probably damaging	1.00
R9026:Nsd3	UTSW	8	25682560	missense	probably benign	0.10
R9281:Nsd3	UTSW	8	25662945	missense	probably benign	0.00
R9320:Nsd3	UTSW	8	25709061	critical splice acceptor site	probably null
R9563:Nsd3	UTSW	8	25714203	missense
R9703:Nsd3	UTSW	8	25641212	missense	probably benign	0.00
X0026:Nsd3	UTSW	8	25700593	missense	probably damaging	1.00
Z1088:Nsd3	UTSW	8	25641002	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGACTTGACATCAAGCTTCAGCC -3'
(R):5'- CCCTGTGAGAAGTGAGAAGTCCAAC -3'

Sequencing Primer
(F):5'- CTCGTCTATTCTGGAGAAATCACG -3'
(R):5'- GTGAGAAGTCCAACTTTAAGTAGC -3'

Posted On

2013-06-12