Mutagenetix > Incidental Mutations

Incidental Mutation 'R6177:Mast3'

487824

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

044319-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6177 (G1)

Quality Score

83.0076

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70790018 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 53 (S53P)

Ref Sequence

ENSEMBL: ENSMUSP00000148291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: S69P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: S69P

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: S53P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212001
AA Change: S77P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212038
AA Change: S53P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212551
AA Change: S53P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212673
AA Change: S25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212757
AA Change: S71P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212875
AA Change: S47P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.348

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.7%

Validation Efficiency

100% (65/65)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,105,750	I102T	possibly damaging	Het
Abcd2	T	C	15: 91,190,693	I306V	probably damaging	Het
Actrt3	A	T	3: 30,598,167	Y259*	probably null	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Ano1	T	A	7: 144,678,741	M25L	possibly damaging	Het
Apol10b	A	T	15: 77,585,787	D63E	possibly damaging	Het
Atp6v1c1	C	A	15: 38,673,928	S55*	probably null	Het
C1s2	T	G	6: 124,630,001	D296A	probably damaging	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Cadm4	G	A	7: 24,502,761	V342M	possibly damaging	Het
Cat	T	C	2: 103,473,075	E119G	probably damaging	Het
Cavin2	G	T	1: 51,289,495	S37I	probably damaging	Het
Cdk5rap2	G	A	4: 70,281,482	R802C	probably damaging	Het
Clip1	A	G	5: 123,613,834		probably benign	Het
Dhx57	T	C	17: 80,272,966	N519S	possibly damaging	Het
Dpep2	T	C	8: 105,986,199	D260G	probably damaging	Het
Edem1	T	A	6: 108,851,198		probably null	Het
Epb41l4a	A	T	18: 33,798,815		probably null	Het
Esp1	T	C	17: 40,728,832	S3P	possibly damaging	Het
Fam111a	A	G	19: 12,587,382	Y165C	probably damaging	Het
Fstl4	A	G	11: 53,168,204	T497A	probably benign	Het
Gm281	T	C	14: 13,868,002	D229G	probably benign	Het
Gstcd	T	C	3: 133,082,073	D288G	probably damaging	Het
Hmcn2	T	A	2: 31,420,106	L3264*	probably null	Het
Hyal4	T	A	6: 24,766,090	L481*	probably null	Het
Ighv2-7	A	G	12: 113,807,435	Y77H	possibly damaging	Het
Jdp2	G	T	12: 85,638,840	R125L	probably benign	Het
Lrp1b	A	T	2: 41,123,736		probably null	Het
Lrp2	AC	A	2: 69,510,419		probably null	Het
Marveld2	C	T	13: 100,597,378	D250N	probably damaging	Het
Myo3b	T	C	2: 70,313,363	V1041A	probably benign	Het
Nkpd1	T	A	7: 19,523,084	F113I	probably damaging	Het
Obscn	A	G	11: 59,032,664	S6470P	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1015	C	T	2: 85,785,660	R50C	probably damaging	Het
Olfr1246	T	C	2: 89,590,317	D266G	possibly damaging	Het
Pdcd11	G	T	19: 47,120,283	G1246V	probably damaging	Het
Phc3	A	T	3: 30,942,565	S219T	probably damaging	Het
Plxnb1	C	T	9: 109,102,925		probably null	Het
Polh	T	C	17: 46,184,744	D276G	possibly damaging	Het
Polq	T	A	16: 37,071,709	V1991E	probably damaging	Het
Polr2g	G	A	19: 8,794,177	R144C	probably damaging	Het
Pramef25	G	A	4: 143,949,006	H417Y	possibly damaging	Het
Prex2	A	C	1: 11,136,777	T520P	possibly damaging	Het
Psg21	T	A	7: 18,652,354	T236S	possibly damaging	Het
Ptpru	A	T	4: 131,793,525	S761R	probably benign	Het
Rapgef6	G	A	11: 54,620,016	R253Q	probably damaging	Het
Rc3h2	C	T	2: 37,389,646	V524I	probably benign	Het
Sde2	T	C	1: 180,858,219	V112A	probably damaging	Het
Sept7	T	C	9: 25,293,804		probably null	Het
Spef2	A	G	15: 9,727,532	V155A	possibly damaging	Het
St7	T	C	6: 17,819,334		probably null	Het
Tmcc3	A	T	10: 94,582,387	Y339F	probably damaging	Het
Tmed6	T	C	8: 107,065,451	E54G	probably damaging	Het
Tnks1bp1	C	T	2: 85,059,280		probably benign	Het
Trim43c	T	C	9: 88,840,547	L82P	possibly damaging	Het
Txndc2	T	C	17: 65,638,471	D237G	probably benign	Het
Vmn1r91	T	A	7: 20,101,479	C108S	possibly damaging	Het
Vtn	A	T	11: 78,500,010	D165V	probably damaging	Het
Wdr3	A	T	3: 100,161,152	S13R	probably damaging	Het
Zdhhc16	A	G	19: 41,937,759	Y31C	probably benign	Het
Zfp39	A	T	11: 58,891,061	W292R	probably benign	Het
Zfp612	A	T	8: 110,089,974	L604F	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	unclassified	probably null
R1208:Mast3	UTSW	8	70788272	unclassified	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- ACACTTACCTCCGGGCAAAG -3'
(R):5'- TATTTGCCTAGGGGTGACTCC -3'

Sequencing Primer
(F):5'- GGGGAAACTGATGGCTGCTG -3'
(R):5'- TGGGTCTCAGAAACCCCTTAAAGG -3'

Posted On

2017-10-10