Incidental Mutation 'R6177:Tmed6'
List |< first << previous [record 55 of 64] next >> last >|
ID487826
Institutional Source Beutler Lab
Gene Symbol Tmed6
Ensembl Gene ENSMUSG00000031919
Gene Nametransmembrane p24 trafficking protein 6
Synonyms1810018I24Rik, 1810015P03Rik
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location107061476-107065644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107065451 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000034393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034392] [ENSMUST00000034393] [ENSMUST00000068388] [ENSMUST00000068421] [ENSMUST00000133925]
Predicted Effect probably benign
Transcript: ENSMUST00000034392
SMART Domains Protein: ENSMUSP00000034392
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PUA 95 170 4.36e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000034393
AA Change: E54G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034393
Gene: ENSMUSG00000031919
AA Change: E54G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EMP24_GP25L 43 228 1.87e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068388
SMART Domains Protein: ENSMUSP00000065586
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 7.5e-39 PFAM
PDB:3K6G|F 318 356 2e-12 PDB
SANT 422 473 1.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068421
SMART Domains Protein: ENSMUSP00000068948
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 296 3e-38 PFAM
Pfam:TERF2_RBM 320 360 5.1e-22 PFAM
SANT 487 538 1.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133925
SMART Domains Protein: ENSMUSP00000118759
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 9.9e-39 PFAM
PDB:3K6G|F 318 358 3e-14 PDB
SANT 486 537 1.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142616
SMART Domains Protein: ENSMUSP00000118589
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
Pfam:TRF 1 178 2.6e-34 PFAM
Meta Mutation Damage Score 0.5230 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Tmed6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Tmed6 APN 8 107065608 missense possibly damaging 0.85
FR4589:Tmed6 UTSW 8 107061598 nonsense probably null
R0077:Tmed6 UTSW 8 107065566 missense probably damaging 0.98
R0653:Tmed6 UTSW 8 107065651 unclassified probably null
R0718:Tmed6 UTSW 8 107061724 missense probably damaging 1.00
R0750:Tmed6 UTSW 8 107061769 missense possibly damaging 0.87
R1497:Tmed6 UTSW 8 107064122 missense probably benign 0.05
R3016:Tmed6 UTSW 8 107065437 missense probably damaging 1.00
R4589:Tmed6 UTSW 8 107064161 missense probably benign 0.31
R4754:Tmed6 UTSW 8 107063730 missense probably damaging 0.99
R5860:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R5861:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R5862:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R5941:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R6225:Tmed6 UTSW 8 107061739 missense probably damaging 0.98
RF034:Tmed6 UTSW 8 107061596 frame shift probably null
RF043:Tmed6 UTSW 8 107061596 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTCACCCAGAGTTGCTC -3'
(R):5'- TTCCACGGGATTGTGAGCAG -3'

Sequencing Primer
(F):5'- GAGTTGCTCTCTAACTGAAGGTCCAC -3'
(R):5'- CTGCAGAAGAACCCACAGAAGG -3'
Posted On2017-10-10