Incidental Mutation 'R6177:Or1e16'
ID 487836
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 044319-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R6177 (G1)
Quality Score 217.468
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73286480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,074,896 (GRCm39) I306V probably damaging Het
Actrt3 A T 3: 30,652,316 (GRCm39) Y259* probably null Het
Ankfy1 G A 11: 72,645,285 (GRCm39) C788Y probably benign Het
Ano1 T A 7: 144,232,478 (GRCm39) M25L possibly damaging Het
Apol10b A T 15: 77,469,987 (GRCm39) D63E possibly damaging Het
Atp6v1c1 C A 15: 38,674,172 (GRCm39) S55* probably null Het
C1s2 T G 6: 124,606,960 (GRCm39) D296A probably damaging Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Cadm4 G A 7: 24,202,186 (GRCm39) V342M possibly damaging Het
Cat T C 2: 103,303,420 (GRCm39) E119G probably damaging Het
Cavin2 G T 1: 51,328,654 (GRCm39) S37I probably damaging Het
Cdhr18 T C 14: 13,868,002 (GRCm38) D229G probably benign Het
Cdk5rap2 G A 4: 70,199,719 (GRCm39) R802C probably damaging Het
Clip1 A G 5: 123,751,897 (GRCm39) probably benign Het
Dhx57 T C 17: 80,580,395 (GRCm39) N519S possibly damaging Het
Dpep2 T C 8: 106,712,831 (GRCm39) D260G probably damaging Het
Edem1 T A 6: 108,828,159 (GRCm39) probably null Het
Epb41l4a A T 18: 33,931,868 (GRCm39) probably null Het
Esp1 T C 17: 41,039,723 (GRCm39) S3P possibly damaging Het
Fam111a A G 19: 12,564,746 (GRCm39) Y165C probably damaging Het
Fstl4 A G 11: 53,059,031 (GRCm39) T497A probably benign Het
Gstcd T C 3: 132,787,834 (GRCm39) D288G probably damaging Het
Hmcn2 T A 2: 31,310,118 (GRCm39) L3264* probably null Het
Hyal4 T A 6: 24,766,089 (GRCm39) L481* probably null Het
Ighv2-7 A G 12: 113,771,055 (GRCm39) Y77H possibly damaging Het
Jdp2 G T 12: 85,685,614 (GRCm39) R125L probably benign Het
Lrp1b A T 2: 41,013,748 (GRCm39) probably null Het
Lrp2 AC A 2: 69,340,763 (GRCm39) probably null Het
Marveld2 C T 13: 100,733,886 (GRCm39) D250N probably damaging Het
Mast3 A G 8: 71,242,662 (GRCm39) S53P probably damaging Het
Ms4a20 A G 19: 11,083,114 (GRCm39) I102T possibly damaging Het
Myo3b T C 2: 70,143,707 (GRCm39) V1041A probably benign Het
Nkpd1 T A 7: 19,257,009 (GRCm39) F113I probably damaging Het
Obscn A G 11: 58,923,490 (GRCm39) S6470P probably damaging Het
Or4a73 T C 2: 89,420,661 (GRCm39) D266G possibly damaging Het
Or9g4b C T 2: 85,616,004 (GRCm39) R50C probably damaging Het
Pdcd11 G T 19: 47,108,722 (GRCm39) G1246V probably damaging Het
Phc3 A T 3: 30,996,714 (GRCm39) S219T probably damaging Het
Plxnb1 C T 9: 108,931,993 (GRCm39) probably null Het
Polh T C 17: 46,495,670 (GRCm39) D276G possibly damaging Het
Polq T A 16: 36,892,071 (GRCm39) V1991E probably damaging Het
Polr2g G A 19: 8,771,541 (GRCm39) R144C probably damaging Het
Pramel16 G A 4: 143,675,576 (GRCm39) H417Y possibly damaging Het
Prex2 A C 1: 11,207,001 (GRCm39) T520P possibly damaging Het
Psg21 T A 7: 18,386,279 (GRCm39) T236S possibly damaging Het
Ptpru A T 4: 131,520,836 (GRCm39) S761R probably benign Het
Rapgef6 G A 11: 54,510,842 (GRCm39) R253Q probably damaging Het
Rc3h2 C T 2: 37,279,658 (GRCm39) V524I probably benign Het
Sde2 T C 1: 180,685,784 (GRCm39) V112A probably damaging Het
Septin7 T C 9: 25,205,100 (GRCm39) probably null Het
Spef2 A G 15: 9,727,618 (GRCm39) V155A possibly damaging Het
St7 T C 6: 17,819,333 (GRCm39) probably null Het
Tmcc3 A T 10: 94,418,249 (GRCm39) Y339F probably damaging Het
Tmed6 T C 8: 107,792,083 (GRCm39) E54G probably damaging Het
Tnks1bp1 C T 2: 84,889,624 (GRCm39) probably benign Het
Trim43c T C 9: 88,722,600 (GRCm39) L82P possibly damaging Het
Txndc2 T C 17: 65,945,466 (GRCm39) D237G probably benign Het
Vmn1r91 T A 7: 19,835,404 (GRCm39) C108S possibly damaging Het
Vtn A T 11: 78,390,836 (GRCm39) D165V probably damaging Het
Wdr3 A T 3: 100,068,468 (GRCm39) S13R probably damaging Het
Zdhhc16 A G 19: 41,926,198 (GRCm39) Y31C probably benign Het
Zfp39 A T 11: 58,781,887 (GRCm39) W292R probably benign Het
Zfp612 A T 8: 110,816,606 (GRCm39) L604F probably damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On 2017-10-10