Incidental Mutation 'R6177:Vtn'
ID487837
Institutional Source Beutler Lab
Gene Symbol Vtn
Ensembl Gene ENSMUSG00000017344
Gene Namevitronectin
SynonymsVn
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78499091-78502324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78500010 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000017488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001130] [ENSMUST00000017488] [ENSMUST00000061174] [ENSMUST00000108287] [ENSMUST00000125670]
Predicted Effect probably benign
Transcript: ENSMUST00000001130
SMART Domains Protein: ENSMUSP00000001130
Gene: ENSMUSG00000001103

DomainStartEndE-ValueType
HOX 18 80 2.05e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000017488
AA Change: D165V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017488
Gene: ENSMUSG00000017344
AA Change: D165V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 20 62 2.45e-13 SMART
HX 160 203 7.81e-8 SMART
HX 205 251 2.46e-14 SMART
HX 253 303 9.19e-5 SMART
low complexity region 358 400 N/A INTRINSIC
HX 426 473 1.59e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061174
SMART Domains Protein: ENSMUSP00000051059
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 9.5e-10 SMART
TIR 561 702 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108287
SMART Domains Protein: ENSMUSP00000103922
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 2.15e-8 SMART
TIR 601 742 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125670
SMART Domains Protein: ENSMUSP00000129606
Gene: ENSMUSG00000001103

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153628
Meta Mutation Damage Score 0.3982 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the pexin family. It is found in serum and tissues and promotes cell adhesion and spreading, inhibits the membrane-damaging effect of the terminal cytolytic complement pathway, and binds to several serpin serine protease inhibitors. It is a secreted protein and exists in either a single chain form or a clipped, two chain form held together by a disulfide bond. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes and heterozygotes for a targeted null mutation appear to develop, mature, and reproduce normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Vtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Vtn APN 11 78499374 missense probably benign
IGL02515:Vtn APN 11 78501654 missense probably damaging 1.00
R0722:Vtn UTSW 11 78500854 unclassified probably benign
R1071:Vtn UTSW 11 78501776 missense probably benign 0.00
R1738:Vtn UTSW 11 78499596 missense possibly damaging 0.88
R1848:Vtn UTSW 11 78500567 missense probably damaging 0.99
R1980:Vtn UTSW 11 78501898 missense probably damaging 0.98
R1998:Vtn UTSW 11 78499716 missense probably damaging 1.00
R2125:Vtn UTSW 11 78500223 missense probably damaging 1.00
R4322:Vtn UTSW 11 78500090 unclassified probably benign
R4590:Vtn UTSW 11 78502206 missense probably damaging 1.00
R4771:Vtn UTSW 11 78501574 missense probably benign
R5684:Vtn UTSW 11 78500558 missense probably damaging 1.00
R6716:Vtn UTSW 11 78500226 missense probably damaging 1.00
R7202:Vtn UTSW 11 78500800 missense possibly damaging 0.88
X0058:Vtn UTSW 11 78499952 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGACCTAAATCCTCGGACG -3'
(R):5'- TTGATGCGAGTGAAGGCAGC -3'

Sequencing Primer
(F):5'- TAAATCCTCGGACGGACGG -3'
(R):5'- CCCCAGACATCTTGGATAAGTTTGG -3'
Posted On2017-10-10