Incidental Mutation 'R6177:Marveld2'
List |< first << previous [record 30 of 64] next >> last >|
ID487839
Institutional Source Beutler Lab
Gene Symbol Marveld2
Ensembl Gene ENSMUSG00000021636
Gene NameMARVEL (membrane-associating) domain containing 2
SynonymsTric-b, Tricellulin, Tric, Mrvldc2, Tric-c, Tric-a
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100595957-100616971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100597378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 250 (D250N)
Ref Sequence ENSEMBL: ENSMUSP00000129990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022137] [ENSMUST00000163163] [ENSMUST00000168772] [ENSMUST00000225754]
Predicted Effect probably benign
Transcript: ENSMUST00000022137
AA Change: D527N

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022137
Gene: ENSMUSG00000021636
AA Change: D527N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 4.1e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 2.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163163
AA Change: D250N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129990
Gene: ENSMUSG00000021636
AA Change: D250N

DomainStartEndE-ValueType
low complexity region 25 53 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Pfam:Occludin_ELL 166 268 4.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168772
AA Change: D527N

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126438
Gene: ENSMUSG00000021636
AA Change: D527N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 3.6e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 6.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225754
AA Change: D527N

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein found at the tight junctions between epithelial cells. The encoded protein helps establish epithelial barriers such as those in the organ of Corti, where these barriers are required for normal hearing. Defects in this gene are a cause of deafness autosomal recessive type 49 (DFNB49). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in mutation fisplay syndromic deafness with rapid progressive degeneration of the hair cells, increased body and organ weights and abnormal tricellular tight junctions. However, vestibular function is intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Marveld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Marveld2 APN 13 100600893 missense possibly damaging 0.83
IGL00573:Marveld2 APN 13 100597859 splice site probably benign
R1569:Marveld2 UTSW 13 100600998 missense probably benign 0.32
R1884:Marveld2 UTSW 13 100600621 missense probably benign 0.15
R1958:Marveld2 UTSW 13 100597350 missense probably damaging 1.00
R2249:Marveld2 UTSW 13 100612091 missense probably benign
R2258:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2259:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2260:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2473:Marveld2 UTSW 13 100597321 missense probably damaging 0.98
R3918:Marveld2 UTSW 13 100611893 missense probably benign 0.01
R4010:Marveld2 UTSW 13 100611428 splice site probably null
R4089:Marveld2 UTSW 13 100600480 missense probably benign 0.04
R4634:Marveld2 UTSW 13 100611939 missense probably damaging 1.00
R4775:Marveld2 UTSW 13 100616795 unclassified probably benign
R4961:Marveld2 UTSW 13 100611923 missense probably benign 0.12
R5424:Marveld2 UTSW 13 100612187 missense probably benign
R5546:Marveld2 UTSW 13 100600938 missense probably benign 0.14
R5900:Marveld2 UTSW 13 100611668 missense probably damaging 1.00
R5977:Marveld2 UTSW 13 100611689 missense possibly damaging 0.87
R7409:Marveld2 UTSW 13 100611476 missense probably damaging 0.99
R7484:Marveld2 UTSW 13 100611560 missense probably damaging 1.00
R8142:Marveld2 UTSW 13 100600940 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCAACCAAGCGGAAGATGAC -3'
(R):5'- CATGTATTTTGACTCCTAAGGGTAC -3'

Sequencing Primer
(F):5'- CCAAGCGGAAGATGACCTGGAG -3'
(R):5'- CCTTGGTTTTGCTGTGAACCTAAAAC -3'
Posted On2017-10-10