Mutagenetix > Incidental Mutations

Incidental Mutation 'R6177:Spef2'

487841

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

044319-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R6177 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9727532 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 155 (V155A)

Ref Sequence

ENSEMBL: ENSMUSP00000124891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]

Predicted Effect

probably benign
Transcript: ENSMUST00000041840

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159093
AA Change: V155A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: V155A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159368

SMART Domains

Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	162	1.4e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160236

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162780
AA Change: V155A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: V155A

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	164	1.1e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208854

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,105,750	I102T	possibly damaging	Het
Abcd2	T	C	15: 91,190,693	I306V	probably damaging	Het
Actrt3	A	T	3: 30,598,167	Y259*	probably null	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Ano1	T	A	7: 144,678,741	M25L	possibly damaging	Het
Apol10b	A	T	15: 77,585,787	D63E	possibly damaging	Het
Atp6v1c1	C	A	15: 38,673,928	S55*	probably null	Het
C1s2	T	G	6: 124,630,001	D296A	probably damaging	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Cadm4	G	A	7: 24,502,761	V342M	possibly damaging	Het
Cat	T	C	2: 103,473,075	E119G	probably damaging	Het
Cavin2	G	T	1: 51,289,495	S37I	probably damaging	Het
Cdk5rap2	G	A	4: 70,281,482	R802C	probably damaging	Het
Clip1	A	G	5: 123,613,834		probably benign	Het
Dhx57	T	C	17: 80,272,966	N519S	possibly damaging	Het
Dpep2	T	C	8: 105,986,199	D260G	probably damaging	Het
Edem1	T	A	6: 108,851,198		probably null	Het
Epb41l4a	A	T	18: 33,798,815		probably null	Het
Esp1	T	C	17: 40,728,832	S3P	possibly damaging	Het
Fam111a	A	G	19: 12,587,382	Y165C	probably damaging	Het
Fstl4	A	G	11: 53,168,204	T497A	probably benign	Het
Gm281	T	C	14: 13,868,002	D229G	probably benign	Het
Gstcd	T	C	3: 133,082,073	D288G	probably damaging	Het
Hmcn2	T	A	2: 31,420,106	L3264*	probably null	Het
Hyal4	T	A	6: 24,766,090	L481*	probably null	Het
Ighv2-7	A	G	12: 113,807,435	Y77H	possibly damaging	Het
Jdp2	G	T	12: 85,638,840	R125L	probably benign	Het
Lrp1b	A	T	2: 41,123,736		probably null	Het
Lrp2	AC	A	2: 69,510,419		probably null	Het
Marveld2	C	T	13: 100,597,378	D250N	probably damaging	Het
Mast3	A	G	8: 70,790,018	S53P	probably damaging	Het
Myo3b	T	C	2: 70,313,363	V1041A	probably benign	Het
Nkpd1	T	A	7: 19,523,084	F113I	probably damaging	Het
Obscn	A	G	11: 59,032,664	S6470P	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1015	C	T	2: 85,785,660	R50C	probably damaging	Het
Olfr1246	T	C	2: 89,590,317	D266G	possibly damaging	Het
Pdcd11	G	T	19: 47,120,283	G1246V	probably damaging	Het
Phc3	A	T	3: 30,942,565	S219T	probably damaging	Het
Plxnb1	C	T	9: 109,102,925		probably null	Het
Polh	T	C	17: 46,184,744	D276G	possibly damaging	Het
Polq	T	A	16: 37,071,709	V1991E	probably damaging	Het
Polr2g	G	A	19: 8,794,177	R144C	probably damaging	Het
Pramef25	G	A	4: 143,949,006	H417Y	possibly damaging	Het
Prex2	A	C	1: 11,136,777	T520P	possibly damaging	Het
Psg21	T	A	7: 18,652,354	T236S	possibly damaging	Het
Ptpru	A	T	4: 131,793,525	S761R	probably benign	Het
Rapgef6	G	A	11: 54,620,016	R253Q	probably damaging	Het
Rc3h2	C	T	2: 37,389,646	V524I	probably benign	Het
Sde2	T	C	1: 180,858,219	V112A	probably damaging	Het
Sept7	T	C	9: 25,293,804		probably null	Het
St7	T	C	6: 17,819,334		probably null	Het
Tmcc3	A	T	10: 94,582,387	Y339F	probably damaging	Het
Tmed6	T	C	8: 107,065,451	E54G	probably damaging	Het
Tnks1bp1	C	T	2: 85,059,280		probably benign	Het
Trim43c	T	C	9: 88,840,547	L82P	possibly damaging	Het
Txndc2	T	C	17: 65,638,471	D237G	probably benign	Het
Vmn1r91	T	A	7: 20,101,479	C108S	possibly damaging	Het
Vtn	A	T	11: 78,500,010	D165V	probably damaging	Het
Wdr3	A	T	3: 100,161,152	S13R	probably damaging	Het
Zdhhc16	A	G	19: 41,937,759	Y31C	probably benign	Het
Zfp39	A	T	11: 58,891,061	W292R	probably benign	Het
Zfp612	A	T	8: 110,089,974	L604F	probably damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	synonymous	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7921:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7937:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7938:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7972:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGTGCTTACTACAGGCAG -3'
(R):5'- CGGGATGTGGTATGAGGACC -3'

Sequencing Primer
(F):5'- GTGTGCTTACTACAGGCAGAAATAAC -3'
(R):5'- GACCAAAAGGAAAGAGGTCTTTG -3'

Posted On

2017-10-10