Incidental Mutation 'R6177:Atp6v1c1'
ID487842
Institutional Source Beutler Lab
Gene Symbol Atp6v1c1
Ensembl Gene ENSMUSG00000022295
Gene NameATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms1700025B18Rik
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location38661933-38692446 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 38673928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 55 (S55*)
Ref Sequence ENSEMBL: ENSMUSP00000153731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533] [ENSMUST00000228820]
Predicted Effect probably null
Transcript: ENSMUST00000022904
AA Change: S55*
SMART Domains Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295
AA Change: S55*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 370 1.2e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226487
Predicted Effect probably null
Transcript: ENSMUST00000226533
AA Change: S55*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228486
Predicted Effect probably benign
Transcript: ENSMUST00000228820
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Atp6v1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Atp6v1c1 APN 15 38686856 missense probably damaging 0.99
IGL01371:Atp6v1c1 APN 15 38682960 missense probably benign
IGL02987:Atp6v1c1 APN 15 38690562 missense possibly damaging 0.70
P0029:Atp6v1c1 UTSW 15 38686902 unclassified probably benign
R0550:Atp6v1c1 UTSW 15 38682929 splice site probably benign
R0669:Atp6v1c1 UTSW 15 38677528 missense probably benign 0.00
R2033:Atp6v1c1 UTSW 15 38673966 critical splice donor site probably null
R3021:Atp6v1c1 UTSW 15 38689216 missense possibly damaging 0.75
R4475:Atp6v1c1 UTSW 15 38677573 missense probably benign 0.03
R4612:Atp6v1c1 UTSW 15 38677612 missense probably damaging 1.00
R4798:Atp6v1c1 UTSW 15 38689176 missense probably damaging 1.00
R5095:Atp6v1c1 UTSW 15 38679413 critical splice donor site probably null
R5600:Atp6v1c1 UTSW 15 38686863 missense probably benign 0.17
R6434:Atp6v1c1 UTSW 15 38677546 missense probably damaging 0.99
R6916:Atp6v1c1 UTSW 15 38677581 missense probably benign 0.00
R6973:Atp6v1c1 UTSW 15 38690550 missense probably damaging 1.00
R7395:Atp6v1c1 UTSW 15 38691705 makesense probably null
R7607:Atp6v1c1 UTSW 15 38683011 critical splice donor site probably null
R7712:Atp6v1c1 UTSW 15 38686805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGACCCTTCAGATAAAGATACACC -3'
(R):5'- ACATGCTTGAACCATAGGTGC -3'

Sequencing Primer
(F):5'- TGTAATCCCAGCACTGAAGAG -3'
(R):5'- TGAACCATAGGTGCACATGTG -3'
Posted On2017-10-10