Incidental Mutation 'R6177:Abcd2'
List |< first << previous [record 2 of 64] next >> last >|
ID487844
Institutional Source Beutler Lab
Gene Symbol Abcd2
Ensembl Gene ENSMUSG00000055782
Gene NameATP-binding cassette, sub-family D (ALD), member 2
SynonymsABC39, adrenoleukodystrophy related, ALDL1, ALDR
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location91145871-91191799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91190693 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 306 (I306V)
Ref Sequence ENSEMBL: ENSMUSP00000068940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069511]
Predicted Effect probably damaging
Transcript: ENSMUST00000069511
AA Change: I306V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068940
Gene: ENSMUSG00000055782
AA Change: I306V

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Pfam:ABC_membrane_2 78 365 1.9e-110 PFAM
AAA 504 690 2.79e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230461
Meta Mutation Damage Score 0.4705 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of Abcd1 and/or other peroxisomal ABC transporters. Mutations in the human gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene exhibit a late-onset cerebellar and sensory ataxia, loss of Purkinje cells, dorsal root ganglia cell degeneration, axonal degeneration in the spinal cord, and an accumulation of very long chain fatty acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Abcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Abcd2 APN 15 91149213 splice site probably benign
IGL01515:Abcd2 APN 15 91163086 missense probably damaging 1.00
IGL01733:Abcd2 APN 15 91191614 utr 5 prime probably benign
IGL02084:Abcd2 APN 15 91178327 critical splice acceptor site probably null
IGL02408:Abcd2 APN 15 91178241 missense possibly damaging 0.95
IGL02568:Abcd2 APN 15 91148981 utr 3 prime probably benign
IGL02942:Abcd2 APN 15 91149175 missense probably damaging 0.99
IGL03281:Abcd2 APN 15 91151673 missense probably damaging 1.00
R0463:Abcd2 UTSW 15 91159124 missense probably benign 0.01
R1226:Abcd2 UTSW 15 91191043 missense probably benign
R1510:Abcd2 UTSW 15 91188978 missense probably damaging 1.00
R1581:Abcd2 UTSW 15 91179144 missense probably benign
R1802:Abcd2 UTSW 15 91163102 missense probably benign
R1918:Abcd2 UTSW 15 91191481 missense probably benign
R2184:Abcd2 UTSW 15 91191439 missense probably benign
R3820:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R3821:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R4486:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4487:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4489:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4706:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4707:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4727:Abcd2 UTSW 15 91178286 missense probably benign 0.33
R4872:Abcd2 UTSW 15 91191311 missense probably benign
R4971:Abcd2 UTSW 15 91163110 missense probably benign 0.06
R5492:Abcd2 UTSW 15 91188973 missense probably benign
R6049:Abcd2 UTSW 15 91178236 missense probably benign 0.00
R6143:Abcd2 UTSW 15 91190947 missense possibly damaging 0.95
R6566:Abcd2 UTSW 15 91191118 missense probably damaging 1.00
R7108:Abcd2 UTSW 15 91191274 missense probably benign 0.43
R7208:Abcd2 UTSW 15 91190682 nonsense probably null
R7212:Abcd2 UTSW 15 91159123 missense possibly damaging 0.84
R7497:Abcd2 UTSW 15 91191176 missense probably benign
R7505:Abcd2 UTSW 15 91149057 missense possibly damaging 0.60
R7732:Abcd2 UTSW 15 91191248 missense possibly damaging 0.64
R8119:Abcd2 UTSW 15 91148994 missense probably benign 0.00
R8203:Abcd2 UTSW 15 91191166 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCGATTTAAAGGGCTCATG -3'
(R):5'- ACAGCTACATCCAGAGGAGC -3'

Sequencing Primer
(F):5'- TAGCATGATTTAGCTACGGGGAC -3'
(R):5'- TCCAGAGGAGCAAGCCCTATAG -3'
Posted On2017-10-10