Incidental Mutation 'R6177:Polh'
List |< first << previous [record 41 of 64] next >> last >|
ID487847
Institutional Source Beutler Lab
Gene Symbol Polh
Ensembl Gene ENSMUSG00000023953
Gene Namepolymerase (DNA directed), eta (RAD 30 related)
SynonymsRAD30A
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46172004-46202625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46184744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000024749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024749
AA Change: D276G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953
AA Change: D276G

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes increased susceptibility to UV-induced skin tumors and results in reduced immunoglobulin gene mutations at A-T base pairs with a G-C biased mutation pattern. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Polh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Polh APN 17 46172243 unclassified probably benign
IGL00585:Polh APN 17 46172243 unclassified probably benign
IGL01812:Polh APN 17 46172911 missense probably benign 0.04
IGL01996:Polh APN 17 46173001 missense probably benign 0.00
IGL02578:Polh APN 17 46194292 nonsense probably null
IGL02829:Polh APN 17 46172902 missense possibly damaging 0.82
IGL03003:Polh APN 17 46194366 missense possibly damaging 0.57
R1435:Polh UTSW 17 46194255 missense probably damaging 1.00
R2091:Polh UTSW 17 46181454 splice site probably benign
R2129:Polh UTSW 17 46188088 nonsense probably null
R4226:Polh UTSW 17 46172594 missense probably benign
R4227:Polh UTSW 17 46172594 missense probably benign
R5483:Polh UTSW 17 46172745 missense probably benign 0.01
R5878:Polh UTSW 17 46194325 missense probably damaging 0.99
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6345:Polh UTSW 17 46182738 missense probably benign 0.03
R6545:Polh UTSW 17 46182759 missense possibly damaging 0.74
R6712:Polh UTSW 17 46190729 missense probably benign 0.12
R7054:Polh UTSW 17 46198716 missense probably benign 0.24
R7708:Polh UTSW 17 46172700 missense probably benign 0.00
R7855:Polh UTSW 17 46175248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATCTGGCCCTTTTGAC -3'
(R):5'- TGTTGGACAGCTAAGAGTTTACAG -3'

Sequencing Primer
(F):5'- GCAGGTAATCTCTGAGTTCAAGACC -3'
(R):5'- CAGCTAAGAGTTTACAGGACTAAAG -3'
Posted On2017-10-10