Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Kcnj5'

48785

Institutional Source

Beutler Lab

Gene Symbol

Kcnj5

Ensembl Gene

ENSMUSG00000032034

Gene Name

potassium inwardly-rectifying channel, subfamily J, member 5

Synonyms

GIRK4, Kir3.4

MMRRC Submission

038717-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32314707-32344350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32322974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 15 (I15T)

Ref Sequence

ENSEMBL: ENSMUSP00000149000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034533] [ENSMUST00000214223] [ENSMUST00000216033]

AlphaFold

P48545

Predicted Effect

probably benign
Transcript: ENSMUST00000034533
AA Change: I15T

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034533
Gene: ENSMUSG00000032034
AA Change: I15T

Domain	Start	End	E-Value	Type
Pfam:IRK	54	377	7e-147	PFAM
low complexity region	387	405	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214223
AA Change: I15T

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000216033

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit mild resting tachycardias and reduced muscarinic-gated atrial potassium channel responses to pharmacological stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Kcnj5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Kcnj5	APN	9	32322423	missense	probably damaging	1.00
IGL01700:Kcnj5	APN	9	32322629	missense	probably damaging	1.00
IGL02250:Kcnj5	APN	9	32317756	missense	probably damaging	1.00
IGL02683:Kcnj5	APN	9	32317780	missense	possibly damaging	0.94
IGL02981:Kcnj5	APN	9	32322581	missense	probably damaging	1.00
R0388:Kcnj5	UTSW	9	32317863	missense	probably damaging	1.00
R0464:Kcnj5	UTSW	9	32322973	missense	possibly damaging	0.87
R1711:Kcnj5	UTSW	9	32322569	missense	probably damaging	1.00
R1730:Kcnj5	UTSW	9	32322192	missense	probably damaging	1.00
R1783:Kcnj5	UTSW	9	32322192	missense	probably damaging	1.00
R2203:Kcnj5	UTSW	9	32322900	missense	probably benign	0.43
R2424:Kcnj5	UTSW	9	32322820	missense	probably damaging	1.00
R3701:Kcnj5	UTSW	9	32317828	missense	possibly damaging	0.95
R4459:Kcnj5	UTSW	9	32322395	missense	probably damaging	1.00
R4657:Kcnj5	UTSW	9	32322677	missense	probably benign
R5422:Kcnj5	UTSW	9	32317705	missense	probably benign	0.00
R6073:Kcnj5	UTSW	9	32317800	missense	probably damaging	1.00
R7185:Kcnj5	UTSW	9	32322176	missense	probably damaging	1.00
R7289:Kcnj5	UTSW	9	32322749	missense	probably damaging	1.00
R7294:Kcnj5	UTSW	9	32322749	missense	probably damaging	1.00
R7295:Kcnj5	UTSW	9	32322791	missense	probably damaging	1.00
R7296:Kcnj5	UTSW	9	32322749	missense	probably damaging	1.00
R7450:Kcnj5	UTSW	9	32322195	missense	possibly damaging	0.52
R7688:Kcnj5	UTSW	9	32322968	missense	probably benign	0.00
R7911:Kcnj5	UTSW	9	32322221	missense	probably damaging	1.00
R8506:Kcnj5	UTSW	9	32322332	missense	probably damaging	1.00
Z1177:Kcnj5	UTSW	9	32317698	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- AACAGCCAGGTGATGGTGTAGACC -3'
(R):5'- TCCCATGAGAGTTCCCAGAAGGAAG -3'

Sequencing Primer
(F):5'- AAGCGCCATTTGAGGTCC -3'
(R):5'- GGAAGTAGCCTCCAGTTCTAAATC -3'

Posted On

2013-06-12