Incidental Mutation 'R6177:Fam111a'
List |< first << previous [record 20 of 64] next >> last >|
ID487852
Institutional Source Beutler Lab
Gene Symbol Fam111a
Ensembl Gene ENSMUSG00000024691
Gene Namefamily with sequence similarity 111, member A
Synonyms
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12545740-12589768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12587382 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 165 (Y165C)
Ref Sequence ENSEMBL: ENSMUSP00000123598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025595] [ENSMUST00000144662] [ENSMUST00000151307]
Predicted Effect probably damaging
Transcript: ENSMUST00000025595
AA Change: Y209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025595
Gene: ENSMUSG00000024691
AA Change: Y209C

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 368 557 6.4e-15 PFAM
Pfam:Peptidase_S7 491 574 6.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139270
Predicted Effect probably damaging
Transcript: ENSMUST00000144662
AA Change: Y209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119518
Gene: ENSMUSG00000024691
AA Change: Y209C

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 355 557 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151307
AA Change: Y165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123598
Gene: ENSMUSG00000024691
AA Change: Y165C

DomainStartEndE-ValueType
low complexity region 267 276 N/A INTRINSIC
Pfam:Trypsin 309 536 6.6e-7 PFAM
Pfam:Trypsin_2 324 513 5.6e-15 PFAM
Pfam:Peptidase_S7 447 530 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224046
Meta Mutation Damage Score 0.3635 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is cell-cycle regulated, and has nuclear localization. The C-terminal half of the protein shares homology with trypsin-like peptidases and it contains a PCNA-interacting peptide (PIP) box, that is necessary for its co-localization with proliferating cell nuclear antigen (PCNA). Reduced expression of this gene resulted in DNA replication defects, consistent with the demonstrated role for this gene in Simian Virus 40 (SV40) viral replication. Mutations in this gene have been associated with Kenny-Caffey syndrome (KCS) type 2 and the more severe osteocraniostenosis (OCS, also known as Gracile Bone Dysplasia), both characterized by short stature, hypoparathyroidism, bone development abnormalities, and hypocalcemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Fam111a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Fam111a APN 19 12586954 missense probably damaging 0.96
IGL02721:Fam111a APN 19 12586972 missense probably benign 0.04
IGL02885:Fam111a APN 19 12584124 critical splice donor site probably null
R0121:Fam111a UTSW 19 12584080 missense probably benign 0.00
R0524:Fam111a UTSW 19 12588048 missense probably damaging 1.00
R1553:Fam111a UTSW 19 12587318 missense possibly damaging 0.93
R1583:Fam111a UTSW 19 12587778 missense probably damaging 0.99
R1837:Fam111a UTSW 19 12587452 missense probably benign 0.23
R2945:Fam111a UTSW 19 12587866 nonsense probably null
R3732:Fam111a UTSW 19 12587550 missense possibly damaging 0.57
R4772:Fam111a UTSW 19 12587693 missense probably benign
R4773:Fam111a UTSW 19 12588408 missense possibly damaging 0.91
R4894:Fam111a UTSW 19 12588549 missense probably benign 0.12
R6269:Fam111a UTSW 19 12588443 missense probably benign 0.01
R6330:Fam111a UTSW 19 12586902 missense probably damaging 1.00
R6390:Fam111a UTSW 19 12588160 nonsense probably null
R6448:Fam111a UTSW 19 12588337 missense probably benign 0.04
R6813:Fam111a UTSW 19 12587342 missense probably damaging 1.00
R7620:Fam111a UTSW 19 12587937 missense possibly damaging 0.73
R8291:Fam111a UTSW 19 12587579 missense probably benign 0.01
X0010:Fam111a UTSW 19 12588228 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACTTAAACCTTGGCATGCCC -3'
(R):5'- TTGGTAGCTCAGCTGCAAC -3'

Sequencing Primer
(F):5'- GAAGGCAGCCATGTCGTCATTAC -3'
(R):5'- GCTGCAACCTGAAAAAGCTTG -3'
Posted On2017-10-10