Incidental Mutation 'R6177:Zdhhc16'
ID487853
Institutional Source Beutler Lab
Gene Symbol Zdhhc16
Ensembl Gene ENSMUSG00000025157
Gene Namezinc finger, DHHC domain containing 16
Synonyms1500015N03Rik, Abl-philin 2, APH2
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41933480-41944104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41937759 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 31 (Y31C)
Ref Sequence ENSEMBL: ENSMUSP00000153513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026154] [ENSMUST00000075280] [ENSMUST00000112123] [ENSMUST00000167927] [ENSMUST00000171561] [ENSMUST00000223802] [ENSMUST00000224258] [ENSMUST00000224562] [ENSMUST00000224896] [ENSMUST00000225968]
Predicted Effect probably benign
Transcript: ENSMUST00000026154
AA Change: Y51C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026154
Gene: ENSMUSG00000025157
AA Change: Y51C

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
Pfam:zf-DHHC 151 289 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075280
SMART Domains Protein: ENSMUSP00000074756
Gene: ENSMUSG00000034321

DomainStartEndE-ValueType
Pfam:ECR1_N 8 44 3.8e-12 PFAM
S1 66 147 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112123
SMART Domains Protein: ENSMUSP00000107751
Gene: ENSMUSG00000034321

DomainStartEndE-ValueType
Pfam:ECR1_N 7 41 3.9e-14 PFAM
Pfam:EXOSC1 64 94 7.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171561
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223785
Predicted Effect probably benign
Transcript: ENSMUST00000223802
Predicted Effect probably benign
Transcript: ENSMUST00000224258
AA Change: Y51C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224537
Predicted Effect probably benign
Transcript: ENSMUST00000224562
AA Change: Y51C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000224896
AA Change: Y51C

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225433
Predicted Effect probably benign
Transcript: ENSMUST00000225968
AA Change: Y31C

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display prenatal and neonatal lethality with bradycardia, abnormal heart morphology and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Zdhhc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Zdhhc16 APN 19 41939660 missense probably benign 0.29
IGL01290:Zdhhc16 APN 19 41938048 unclassified probably null
IGL01368:Zdhhc16 APN 19 41941506 unclassified probably null
IGL02191:Zdhhc16 APN 19 41937691 nonsense probably null
FR4342:Zdhhc16 UTSW 19 41942149 intron probably benign
FR4548:Zdhhc16 UTSW 19 41942168 frame shift probably null
PIT4458001:Zdhhc16 UTSW 19 41937770 missense possibly damaging 0.66
R1258:Zdhhc16 UTSW 19 41938044 missense possibly damaging 0.64
R1335:Zdhhc16 UTSW 19 41940634 intron probably null
R1757:Zdhhc16 UTSW 19 41941955 missense probably damaging 1.00
R3833:Zdhhc16 UTSW 19 41938114 critical splice donor site probably null
R4381:Zdhhc16 UTSW 19 41940654 missense possibly damaging 0.63
R4615:Zdhhc16 UTSW 19 41943683 missense possibly damaging 0.74
R5789:Zdhhc16 UTSW 19 41938133 missense probably damaging 1.00
R7252:Zdhhc16 UTSW 19 41941551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTATGACTCAGGCTGGATC -3'
(R):5'- TCCAGAGCTTTGTAAGATGCCTC -3'

Sequencing Primer
(F):5'- GACTCAGGCTGGATCCTTATATTAG -3'
(R):5'- CTTTGTAAGATGCCTCCAAAGCTCAG -3'
Posted On2017-10-10