Incidental Mutation 'R6178:Tbr1'
ID487858
Institutional Source Beutler Lab
Gene Symbol Tbr1
Ensembl Gene ENSMUSG00000035033
Gene NameT-box brain gene 1
Synonyms
MMRRC Submission 044320-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6178 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location61802930-61814114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61804815 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 36 (D36E)
Ref Sequence ENSEMBL: ENSMUSP00000046787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028278] [ENSMUST00000048934] [ENSMUST00000102737]
Predicted Effect probably benign
Transcript: ENSMUST00000028278
SMART Domains Protein: ENSMUSP00000028278
Gene: ENSMUSG00000026914

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
JAB_MPN 30 165 3.71e-49 SMART
Pfam:MitMem_reg 173 307 9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000048934
AA Change: D36E

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: D36E

DomainStartEndE-ValueType
low complexity region 108 122 N/A INTRINSIC
TBOX 203 398 1.6e-125 SMART
Pfam:T-box_assoc 418 679 9.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102737
SMART Domains Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033

DomainStartEndE-ValueType
TBOX 1 135 5.05e-41 SMART
low complexity region 184 193 N/A INTRINSIC
low complexity region 306 315 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154627
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mau2 A G 8: 70,042,537 I50T probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Naa16 T C 14: 79,383,340 I100V possibly damaging Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Robo4 C T 9: 37,405,630 Q414* probably null Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tgfb1i1 T C 7: 128,253,345 F478L probably damaging Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zfp65 G A 13: 67,710,318 P76S probably benign Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in Tbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tbr1 APN 2 61805281 missense probably benign 0.14
IGL01309:Tbr1 APN 2 61806067 missense possibly damaging 0.92
IGL02161:Tbr1 APN 2 61805239 nonsense probably null
IGL02256:Tbr1 APN 2 61804874 missense probably damaging 0.99
IGL02336:Tbr1 APN 2 61804992 missense possibly damaging 0.93
IGL02526:Tbr1 APN 2 61811698 missense probably benign 0.00
FR4340:Tbr1 UTSW 2 61806347 intron probably benign
R0594:Tbr1 UTSW 2 61811620 missense possibly damaging 0.49
R0847:Tbr1 UTSW 2 61805029 missense probably benign 0.00
R1101:Tbr1 UTSW 2 61804739 missense probably benign 0.00
R1247:Tbr1 UTSW 2 61811618 missense possibly damaging 0.78
R1944:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R3080:Tbr1 UTSW 2 61807291 nonsense probably null
R4110:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4111:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4440:Tbr1 UTSW 2 61804838 missense possibly damaging 0.92
R4790:Tbr1 UTSW 2 61811588 missense probably benign 0.04
R4979:Tbr1 UTSW 2 61805249 unclassified probably null
R5054:Tbr1 UTSW 2 61806002 missense possibly damaging 0.83
R5283:Tbr1 UTSW 2 61804900 missense probably benign 0.00
R5545:Tbr1 UTSW 2 61807376 missense possibly damaging 0.93
R6290:Tbr1 UTSW 2 61805050 missense probably benign
R6389:Tbr1 UTSW 2 61806287 start gained probably benign
R6637:Tbr1 UTSW 2 61811630 missense probably benign 0.17
R6983:Tbr1 UTSW 2 61811735 missense probably damaging 1.00
R7021:Tbr1 UTSW 2 61807344 missense probably benign 0.18
R7112:Tbr1 UTSW 2 61811816 missense probably benign 0.02
R7254:Tbr1 UTSW 2 61806042 missense probably damaging 1.00
R7291:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R7438:Tbr1 UTSW 2 61804817 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAACCTTTGAGAAGCATTTGCTG -3'
(R):5'- TGTGACGAAGCTCAGAGACC -3'

Sequencing Primer
(F):5'- GTGGATTCCTAGTGTATGATAAACAG -3'
(R):5'- GAAGCTCAGAGACCCCGTC -3'
Posted On2017-10-10