Incidental Mutation 'R0524:Ubash3b'
ID 48786
Institutional Source Beutler Lab
Gene Symbol Ubash3b
Ensembl Gene ENSMUSG00000032020
Gene Name ubiquitin associated and SH3 domain containing, B
Synonyms 2810457I06Rik, TULA-2
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.223) question?
Stock # R0524 (G1)
Quality Score 182
Status Not validated
Chromosome 9
Chromosomal Location 41011098-41161697 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41016608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 468 (M468K)
Ref Sequence ENSEMBL: ENSMUSP00000116038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044155] [ENSMUST00000151485]
AlphaFold Q8BGG7
Predicted Effect probably benign
Transcript: ENSMUST00000044155
AA Change: M590K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043865
Gene: ENSMUSG00000032020
AA Change: M590K

DomainStartEndE-ValueType
UBA 26 64 2.43e-4 SMART
low complexity region 177 186 N/A INTRINSIC
SH3 246 307 7.29e-10 SMART
Pfam:His_Phos_1 415 598 3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151485
AA Change: M468K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116038
Gene: ENSMUSG00000032020
AA Change: M468K

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
SH3 124 185 7.29e-10 SMART
Pfam:His_Phos_1 252 450 1.9e-27 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, developmentally normal, and do not display any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Ubash3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ubash3b APN 9 41018015 critical splice donor site probably null
IGL01734:Ubash3b APN 9 41026247 splice site probably benign
IGL02311:Ubash3b APN 9 41047037 missense probably benign
IGL03406:Ubash3b APN 9 41037479 missense probably damaging 1.00
PIT4618001:Ubash3b UTSW 9 41016627 missense probably benign 0.00
PIT4687001:Ubash3b UTSW 9 41023518 missense probably damaging 1.00
R0666:Ubash3b UTSW 9 41047064 missense possibly damaging 0.67
R0927:Ubash3b UTSW 9 41023557 nonsense probably null
R1112:Ubash3b UTSW 9 41028116 missense probably damaging 1.00
R1544:Ubash3b UTSW 9 41016605 missense probably damaging 1.00
R1596:Ubash3b UTSW 9 41031497 missense probably benign
R1610:Ubash3b UTSW 9 41043500 missense probably damaging 1.00
R2069:Ubash3b UTSW 9 41043573 missense possibly damaging 0.82
R2507:Ubash3b UTSW 9 41157354 missense possibly damaging 0.90
R2520:Ubash3b UTSW 9 41014947 missense probably damaging 1.00
R3899:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R3900:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R4715:Ubash3b UTSW 9 41016600 missense probably damaging 1.00
R4876:Ubash3b UTSW 9 41018109 missense probably benign 0.00
R5023:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5034:Ubash3b UTSW 9 41029740 missense probably benign 0.25
R5057:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5396:Ubash3b UTSW 9 41043473 critical splice donor site probably null
R5448:Ubash3b UTSW 9 41037435 critical splice donor site probably null
R5760:Ubash3b UTSW 9 41077423 missense probably benign 0.00
R6178:Ubash3b UTSW 9 41014916 missense probably damaging 0.96
R6392:Ubash3b UTSW 9 41014972 missense probably damaging 1.00
R8115:Ubash3b UTSW 9 41026328 missense probably damaging 1.00
R8406:Ubash3b UTSW 9 41029675 missense probably damaging 1.00
R8411:Ubash3b UTSW 9 41043485 missense probably benign 0.02
R8678:Ubash3b UTSW 9 41031489 missense probably benign
R9280:Ubash3b UTSW 9 41161581 missense unknown
R9559:Ubash3b UTSW 9 41043630 missense probably damaging 1.00
R9775:Ubash3b UTSW 9 41014918 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACGAAGCTCCACTGAACACATCTTG -3'
(R):5'- AGTAGATTCTCCTGCCCTACATTGACC -3'

Sequencing Primer
(F):5'- GGCTCAGCAGAAAATTCTGC -3'
(R):5'- ccaggaccaaacccagag -3'
Posted On 2013-06-12