Incidental Mutation 'R0524:Pias1'
ID48787
Institutional Source Beutler Lab
Gene Symbol Pias1
Ensembl Gene ENSMUSG00000032405
Gene Nameprotein inhibitor of activated STAT 1
SynonymsDdxbp1, GBP, 2900068C24Rik
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62878368-62987924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62952178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 16 (V16A)
Ref Sequence ENSEMBL: ENSMUSP00000150834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098651] [ENSMUST00000214830] [ENSMUST00000216209]
Predicted Effect probably damaging
Transcript: ENSMUST00000098651
AA Change: V16A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096248
Gene: ENSMUSG00000032405
AA Change: V16A

DomainStartEndE-ValueType
SAP 11 45 5.3e-5 SMART
low complexity region 82 95 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:PINIT 135 286 9.6e-41 PFAM
Pfam:zf-MIZ 331 380 1.4e-23 PFAM
low complexity region 465 474 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214830
AA Change: V16A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215455
Predicted Effect probably damaging
Transcript: ENSMUST00000216209
AA Change: V7A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.5460 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial perinatal lethality, reduced body size, decreased susceptibility to viral infection, and increased susceptibility to bacterial infection and LPS-induced endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Pias1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pias1 APN 9 62923296 missense probably damaging 0.96
IGL01011:Pias1 APN 9 62912855 missense probably benign 0.00
IGL02412:Pias1 APN 9 62893139 missense probably benign 0.44
IGL02728:Pias1 APN 9 62923644 missense probably damaging 1.00
IGL02728:Pias1 APN 9 62923645 missense possibly damaging 0.80
R0479:Pias1 UTSW 9 62893118 splice site probably benign
R0494:Pias1 UTSW 9 62887311 nonsense probably null
R0558:Pias1 UTSW 9 62882009 missense possibly damaging 0.82
R1279:Pias1 UTSW 9 62892145 missense probably damaging 0.98
R1525:Pias1 UTSW 9 62920487 missense probably damaging 1.00
R1769:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R2157:Pias1 UTSW 9 62912830 missense possibly damaging 0.63
R2201:Pias1 UTSW 9 62951855 missense possibly damaging 0.94
R4193:Pias1 UTSW 9 62952004 missense possibly damaging 0.80
R4726:Pias1 UTSW 9 62920489 missense probably damaging 0.96
R4880:Pias1 UTSW 9 62912798 missense probably benign 0.32
R5107:Pias1 UTSW 9 62882228 missense probably benign 0.11
R5574:Pias1 UTSW 9 62920493 missense probably damaging 0.99
R5634:Pias1 UTSW 9 62895973 missense probably benign 0.10
R5869:Pias1 UTSW 9 62912766 missense probably benign 0.06
R6518:Pias1 UTSW 9 62951860 missense probably damaging 1.00
R6634:Pias1 UTSW 9 62919424 missense probably damaging 1.00
R6798:Pias1 UTSW 9 62892169 missense probably benign
R6799:Pias1 UTSW 9 62882052 missense probably benign 0.10
R7099:Pias1 UTSW 9 62881145 missense
X0017:Pias1 UTSW 9 62980845 splice site probably null
Z1177:Pias1 UTSW 9 62912823 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATTTTCTGAGGGAACCGCCTCCTG -3'
(R):5'- AAAGCGAGATGTGGTCCTGCATAG -3'

Sequencing Primer
(F):5'- GGAACCGCCTCCTGTAGAG -3'
(R):5'- TGGTCCTGCATAGTGTAAGC -3'
Posted On2013-06-12