Incidental Mutation 'R6178:Abcc6'
ID 487873
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 044320-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.788) question?
Stock # R6178 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45678468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 61 (I61V)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850] [ENSMUST00000033121]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: I61V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I61V

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033121
SMART Domains Protein: ENSMUSP00000033121
Gene: ENSMUSG00000030835

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
internal_repeat_1 22 215 2.35e-7 PROSPERO
Pfam:CarboxypepD_reg 322 395 3.5e-12 PFAM
Pfam:DUF2012 331 401 5.7e-10 PFAM
low complexity region 709 732 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
Blast:FN3 913 1017 6e-22 BLAST
low complexity region 1156 1164 N/A INTRINSIC
low complexity region 1203 1214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,542,598 (GRCm39) T616I possibly damaging Het
Aktip T C 8: 91,852,671 (GRCm39) N195S probably damaging Het
Ankfy1 G A 11: 72,645,285 (GRCm39) C788Y probably benign Het
Atg7 T A 6: 114,701,856 (GRCm39) I621N probably damaging Het
Becn1 T A 11: 101,182,336 (GRCm39) I283F probably damaging Het
Btnl12 T C 16: 37,676,422 (GRCm39) Y115C probably damaging Het
C4b T C 17: 34,952,380 (GRCm39) T1220A probably benign Het
Celsr1 C A 15: 85,785,222 (GRCm39) R3004M probably benign Het
Clspn A T 4: 126,471,529 (GRCm39) probably null Het
Csmd3 T C 15: 48,536,854 (GRCm39) Y116C probably damaging Het
Dcp1a T G 14: 30,245,261 (GRCm39) *603G probably null Het
Dmrtc1b C T X: 101,757,169 (GRCm39) P205S possibly damaging Het
Fev G T 1: 74,923,698 (GRCm39) probably benign Het
Fry T A 5: 150,377,987 (GRCm39) V393E probably damaging Het
Gm30646 A G 7: 30,132,081 (GRCm39) probably null Het
Gm3676 C T 14: 41,363,452 (GRCm39) E175K probably benign Het
Gm4847 T C 1: 166,469,905 (GRCm39) Y56C probably damaging Het
Gm5422 T C 10: 31,125,688 (GRCm39) noncoding transcript Het
Gstm6 A G 3: 107,848,397 (GRCm39) V174A probably benign Het
Isoc1 G T 18: 58,804,664 (GRCm39) V191F possibly damaging Het
Kalrn T A 16: 33,874,009 (GRCm39) D132V possibly damaging Het
Kcp T C 6: 29,482,887 (GRCm39) D1394G possibly damaging Het
Marchf10 T G 11: 105,280,440 (GRCm39) D615A probably damaging Het
Mau2 A G 8: 70,495,187 (GRCm39) I50T probably damaging Het
Mgp A G 6: 136,849,722 (GRCm39) C79R probably damaging Het
Mpdz T A 4: 81,226,602 (GRCm39) K1344N probably damaging Het
Mrgpre T A 7: 143,334,708 (GRCm39) Y265F possibly damaging Het
Mro G A 18: 74,006,295 (GRCm39) V80M possibly damaging Het
Mrpl44 G T 1: 79,755,895 (GRCm39) C167F possibly damaging Het
Muc5b A G 7: 141,410,079 (GRCm39) M1218V probably null Het
Naa16 T C 14: 79,620,780 (GRCm39) I100V possibly damaging Het
Nup205 A T 6: 35,220,778 (GRCm39) Y1860F possibly damaging Het
Or10aa3 A T 1: 173,878,533 (GRCm39) Y198F probably benign Het
Or14c40 A G 7: 86,313,819 (GRCm39) I316M probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or4c103 T C 2: 88,513,977 (GRCm39) Y33C probably damaging Het
Plcb3 A G 19: 6,932,071 (GRCm39) probably null Het
Pnpla3 G A 15: 84,065,132 (GRCm39) A309T probably benign Het
Ranbp10 A G 8: 106,498,296 (GRCm39) S624P possibly damaging Het
Ripor2 T C 13: 24,894,113 (GRCm39) S714P possibly damaging Het
Robo4 C T 9: 37,316,926 (GRCm39) Q414* probably null Het
Shc2 A G 10: 79,465,954 (GRCm39) I161T probably damaging Het
Slc35b2 C T 17: 45,877,302 (GRCm39) T143I probably benign Het
Slc39a13 T C 2: 90,898,880 (GRCm39) D77G probably damaging Het
Snx6 A C 12: 54,807,249 (GRCm39) D243E probably damaging Het
Taar8b A G 10: 23,967,711 (GRCm39) V161A probably benign Het
Tbr1 T A 2: 61,635,159 (GRCm39) D36E possibly damaging Het
Tdpoz2 T C 3: 93,559,618 (GRCm39) N118S probably benign Het
Tgfb1i1 T C 7: 127,852,517 (GRCm39) F478L probably damaging Het
Tmprss11f T C 5: 86,704,837 (GRCm39) D27G probably benign Het
Trim30d T G 7: 104,137,202 (GRCm39) M1L probably damaging Het
Trpm7 A G 2: 126,679,301 (GRCm39) V420A probably damaging Het
Ubap2 G T 4: 41,206,981 (GRCm39) P199H probably benign Het
Ubash3b T C 9: 40,926,212 (GRCm39) T512A probably damaging Het
Zfp65 G A 13: 67,858,437 (GRCm39) P76S probably benign Het
Zic5 A T 14: 122,696,748 (GRCm39) H622Q unknown Het
Zpld1 A T 16: 55,053,993 (GRCm39) N266K probably damaging Het
Zswim1 A G 2: 164,667,972 (GRCm39) probably null Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTTATCTCAGTCCCCTC -3'
(R):5'- GGACTCGGGTGGCTAACATC -3'

Sequencing Primer
(F):5'- CACTATTGATCTGGCTGGTTAAC -3'
(R):5'- GTGGCTAACATCCTAATGGTGTCC -3'
Posted On 2017-10-10