Incidental Mutation 'R0524:Lamb2'
ID 48788
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Name laminin, beta 2
Synonyms Lams, npht, Lamb-2
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.854) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 108357080-108367729 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108361571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 676 (R676G)
Ref Sequence ENSEMBL: ENSMUSP00000069087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065014] [ENSMUST00000194147] [ENSMUST00000195058] [ENSMUST00000195483]
AlphaFold Q61292
Predicted Effect possibly damaging
Transcript: ENSMUST00000065014
AA Change: R676G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: R676G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193301
Predicted Effect probably benign
Transcript: ENSMUST00000194147
SMART Domains Protein: ENSMUSP00000141562
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
low complexity region 59 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194421
Predicted Effect probably benign
Transcript: ENSMUST00000195058
SMART Domains Protein: ENSMUSP00000141757
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Laminin_N 50 102 6.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195483
SMART Domains Protein: ENSMUSP00000142304
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 125 3e-3 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108,364,932 (GRCm39) splice site probably null
IGL02072:Lamb2 APN 9 108,359,107 (GRCm39) nonsense probably null
IGL02079:Lamb2 APN 9 108,359,312 (GRCm39) missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108,364,318 (GRCm39) missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108,366,559 (GRCm39) missense probably benign 0.00
IGL02199:Lamb2 APN 9 108,357,824 (GRCm39) missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108,364,741 (GRCm39) missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108,364,348 (GRCm39) missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108,359,755 (GRCm39) missense probably benign 0.12
R0053:Lamb2 UTSW 9 108,363,936 (GRCm39) nonsense probably null
R0053:Lamb2 UTSW 9 108,363,936 (GRCm39) nonsense probably null
R0122:Lamb2 UTSW 9 108,363,713 (GRCm39) missense probably benign 0.01
R0452:Lamb2 UTSW 9 108,363,553 (GRCm39) unclassified probably benign
R0605:Lamb2 UTSW 9 108,363,304 (GRCm39) unclassified probably benign
R0737:Lamb2 UTSW 9 108,360,993 (GRCm39) missense probably benign 0.03
R1083:Lamb2 UTSW 9 108,360,892 (GRCm39) missense probably benign
R1159:Lamb2 UTSW 9 108,358,607 (GRCm39) missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108,359,007 (GRCm39) missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108,367,581 (GRCm39) missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108,359,824 (GRCm39) missense probably benign 0.00
R1576:Lamb2 UTSW 9 108,357,506 (GRCm39) missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108,358,622 (GRCm39) critical splice donor site probably null
R1678:Lamb2 UTSW 9 108,360,885 (GRCm39) critical splice acceptor site probably null
R1740:Lamb2 UTSW 9 108,359,127 (GRCm39) missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108,365,298 (GRCm39) missense probably benign
R1846:Lamb2 UTSW 9 108,364,586 (GRCm39) missense probably benign 0.00
R1863:Lamb2 UTSW 9 108,358,583 (GRCm39) missense probably benign 0.13
R2184:Lamb2 UTSW 9 108,357,752 (GRCm39) missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108,357,809 (GRCm39) missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108,359,340 (GRCm39) missense probably benign 0.20
R2483:Lamb2 UTSW 9 108,357,758 (GRCm39) missense probably damaging 1.00
R4084:Lamb2 UTSW 9 108,365,217 (GRCm39) missense probably benign 0.17
R4164:Lamb2 UTSW 9 108,367,497 (GRCm39) missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108,363,410 (GRCm39) missense probably benign 0.42
R4422:Lamb2 UTSW 9 108,360,754 (GRCm39) missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108,363,997 (GRCm39) missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108,361,226 (GRCm39) splice site probably null
R4935:Lamb2 UTSW 9 108,364,700 (GRCm39) missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108,364,846 (GRCm39) missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108,364,937 (GRCm39) missense probably benign
R5499:Lamb2 UTSW 9 108,365,001 (GRCm39) missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108,357,950 (GRCm39) splice site probably null
R5932:Lamb2 UTSW 9 108,357,810 (GRCm39) missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108,357,587 (GRCm39) missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108,364,811 (GRCm39) nonsense probably null
R6142:Lamb2 UTSW 9 108,362,817 (GRCm39) nonsense probably null
R6245:Lamb2 UTSW 9 108,365,398 (GRCm39) splice site probably null
R6531:Lamb2 UTSW 9 108,360,925 (GRCm39) missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108,365,599 (GRCm39) missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108,364,207 (GRCm39) missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108,358,496 (GRCm39) missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108,366,687 (GRCm39) missense probably benign 0.00
R7116:Lamb2 UTSW 9 108,364,522 (GRCm39) missense probably damaging 1.00
R7146:Lamb2 UTSW 9 108,361,283 (GRCm39) missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108,358,496 (GRCm39) missense probably damaging 1.00
R7288:Lamb2 UTSW 9 108,365,523 (GRCm39) missense probably benign 0.20
R7404:Lamb2 UTSW 9 108,364,782 (GRCm39) missense probably damaging 1.00
R7456:Lamb2 UTSW 9 108,362,979 (GRCm39) missense possibly damaging 0.95
R7472:Lamb2 UTSW 9 108,363,347 (GRCm39) missense probably benign 0.01
R7623:Lamb2 UTSW 9 108,366,423 (GRCm39) missense possibly damaging 0.62
R8125:Lamb2 UTSW 9 108,364,722 (GRCm39) missense probably benign
R8153:Lamb2 UTSW 9 108,357,845 (GRCm39) missense probably damaging 0.99
R8154:Lamb2 UTSW 9 108,357,845 (GRCm39) missense probably damaging 0.99
R8155:Lamb2 UTSW 9 108,357,845 (GRCm39) missense probably damaging 0.99
R8156:Lamb2 UTSW 9 108,357,845 (GRCm39) missense probably damaging 0.99
R8157:Lamb2 UTSW 9 108,357,845 (GRCm39) missense probably damaging 0.99
R8419:Lamb2 UTSW 9 108,365,563 (GRCm39) missense probably benign 0.00
R8695:Lamb2 UTSW 9 108,363,365 (GRCm39) missense probably benign 0.08
R8825:Lamb2 UTSW 9 108,362,460 (GRCm39) missense probably benign 0.01
R9005:Lamb2 UTSW 9 108,361,370 (GRCm39) critical splice donor site probably null
R9315:Lamb2 UTSW 9 108,364,366 (GRCm39) missense possibly damaging 0.77
R9398:Lamb2 UTSW 9 108,364,366 (GRCm39) missense possibly damaging 0.77
R9419:Lamb2 UTSW 9 108,356,959 (GRCm39) missense unknown
R9450:Lamb2 UTSW 9 108,357,760 (GRCm39) nonsense probably null
R9495:Lamb2 UTSW 9 108,358,006 (GRCm39) missense probably damaging 1.00
R9514:Lamb2 UTSW 9 108,358,006 (GRCm39) missense probably damaging 1.00
R9529:Lamb2 UTSW 9 108,363,477 (GRCm39) missense probably benign 0.05
R9532:Lamb2 UTSW 9 108,365,830 (GRCm39) missense probably damaging 1.00
R9534:Lamb2 UTSW 9 108,365,830 (GRCm39) missense probably damaging 1.00
R9734:Lamb2 UTSW 9 108,365,830 (GRCm39) missense probably damaging 1.00
Z1176:Lamb2 UTSW 9 108,360,100 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGACCTGTGCTGACATTC -3'
(R):5'- TTACGCCACTGCAACTGTCACC -3'

Sequencing Primer
(F):5'- ACATTCTGGGTGTGGAAGC -3'
(R):5'- ACCATCATAAGGCTGTTTCGG -3'
Posted On 2013-06-12