Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Lamb2'

48788

Institutional Source

Beutler Lab

Gene Symbol

Lamb2

Ensembl Gene

ENSMUSG00000052911

Gene Name

laminin, beta 2

Synonyms

Lams, npht, Lamb-2

MMRRC Submission

038717-MU

Accession Numbers

Genbank: NM_008483; MGI: 99916

Essential gene?

Probably essential (E-score: 0.831) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108479736-108490530 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108484372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 676 (R676G)

Ref Sequence

ENSEMBL: ENSMUSP00000069087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065014] [ENSMUST00000194147] [ENSMUST00000195058] [ENSMUST00000195483]

AlphaFold

Q61292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065014
AA Change: R676G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: R676G

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamNT	44	284	1.9e-102	SMART
EGF_Lam	286	347	1.34e-6	SMART
EGF_Lam	350	410	6.1e-10	SMART
EGF_Lam	413	470	2.98e-13	SMART
EGF_Lam	473	522	7.93e-9	SMART
EGF_Lam	525	569	1.01e-10	SMART
EGF_Lam	784	829	3.42e-13	SMART
EGF_Lam	832	875	6.54e-10	SMART
EGF_Lam	878	925	1.34e-6	SMART
EGF_Lam	928	984	4.74e-7	SMART
EGF_Lam	987	1036	1.53e-10	SMART
EGF_Lam	1039	1093	6.29e-12	SMART
EGF_Lam	1096	1141	1.79e-7	SMART
EGF_Lam	1144	1188	6.64e-11	SMART
coiled coil region	1261	1299	N/A	INTRINSIC
low complexity region	1445	1458	N/A	INTRINSIC
coiled coil region	1473	1527	N/A	INTRINSIC
low complexity region	1609	1625	N/A	INTRINSIC
SCOP:d1eq1a_	1632	1786	5e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193301

Predicted Effect

probably benign
Transcript: ENSMUST00000194147

SMART Domains

Protein: ENSMUSP00000141562
Gene: ENSMUSG00000052911

Domain	Start	End	E-Value	Type
low complexity region	59	79	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194421

Predicted Effect

probably benign
Transcript: ENSMUST00000195058

SMART Domains

Protein: ENSMUSP00000141757
Gene: ENSMUSG00000052911

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
Pfam:Laminin_N	50	102	6.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195483

SMART Domains

Protein: ENSMUSP00000142304
Gene: ENSMUSG00000052911

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamNT	44	125	3e-3	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Lamb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01370:Lamb2	APN	9	108487733	splice site	probably null
IGL02072:Lamb2	APN	9	108481908	nonsense	probably null
IGL02079:Lamb2	APN	9	108482113	missense	probably damaging	1.00
IGL02087:Lamb2	APN	9	108487119	missense	possibly damaging	0.95
IGL02193:Lamb2	APN	9	108489360	missense	probably benign	0.00
IGL02199:Lamb2	APN	9	108480625	missense	possibly damaging	0.49
IGL02201:Lamb2	APN	9	108487542	missense	probably damaging	1.00
IGL02468:Lamb2	APN	9	108487149	missense	probably damaging	1.00
F6893:Lamb2	UTSW	9	108482556	missense	probably benign	0.12
R0053:Lamb2	UTSW	9	108486737	nonsense	probably null
R0053:Lamb2	UTSW	9	108486737	nonsense	probably null
R0122:Lamb2	UTSW	9	108486514	missense	probably benign	0.01
R0452:Lamb2	UTSW	9	108486354	unclassified	probably benign
R0605:Lamb2	UTSW	9	108486105	unclassified	probably benign
R0737:Lamb2	UTSW	9	108483794	missense	probably benign	0.03
R1083:Lamb2	UTSW	9	108483693	missense	probably benign
R1159:Lamb2	UTSW	9	108481408	missense	probably damaging	1.00
R1283:Lamb2	UTSW	9	108481808	missense	possibly damaging	0.46
R1507:Lamb2	UTSW	9	108490382	missense	probably damaging	1.00
R1547:Lamb2	UTSW	9	108482625	missense	probably benign	0.00
R1576:Lamb2	UTSW	9	108480307	missense	probably damaging	0.96
R1647:Lamb2	UTSW	9	108481423	critical splice donor site	probably null
R1678:Lamb2	UTSW	9	108483686	critical splice acceptor site	probably null
R1740:Lamb2	UTSW	9	108481928	missense	probably damaging	1.00
R1803:Lamb2	UTSW	9	108488099	missense	probably benign
R1846:Lamb2	UTSW	9	108487387	missense	probably benign	0.00
R1863:Lamb2	UTSW	9	108481384	missense	probably benign	0.13
R2184:Lamb2	UTSW	9	108480553	missense	probably damaging	1.00
R2262:Lamb2	UTSW	9	108480610	missense	probably damaging	1.00
R2338:Lamb2	UTSW	9	108482141	missense	probably benign	0.20
R2483:Lamb2	UTSW	9	108480559	missense	probably damaging	1.00
R4084:Lamb2	UTSW	9	108488018	missense	probably benign	0.17
R4164:Lamb2	UTSW	9	108490298	missense	probably damaging	1.00
R4295:Lamb2	UTSW	9	108486211	missense	probably benign	0.42
R4422:Lamb2	UTSW	9	108483555	missense	probably damaging	0.99
R4497:Lamb2	UTSW	9	108486798	missense	probably damaging	1.00
R4880:Lamb2	UTSW	9	108484027	splice site	probably null
R4935:Lamb2	UTSW	9	108487501	missense	possibly damaging	0.93
R4977:Lamb2	UTSW	9	108487647	missense	probably damaging	0.99
R5152:Lamb2	UTSW	9	108487738	missense	probably benign
R5499:Lamb2	UTSW	9	108487802	missense	possibly damaging	0.50
R5724:Lamb2	UTSW	9	108480751	splice site	probably null
R5932:Lamb2	UTSW	9	108480611	missense	probably damaging	1.00
R5997:Lamb2	UTSW	9	108480388	missense	possibly damaging	0.65
R6052:Lamb2	UTSW	9	108487612	nonsense	probably null
R6142:Lamb2	UTSW	9	108485618	nonsense	probably null
R6245:Lamb2	UTSW	9	108488199	splice site	probably null
R6531:Lamb2	UTSW	9	108483726	missense	possibly damaging	0.78
R6557:Lamb2	UTSW	9	108488400	missense	probably damaging	1.00
R6562:Lamb2	UTSW	9	108487008	missense	possibly damaging	0.56
R6997:Lamb2	UTSW	9	108481297	missense	probably damaging	1.00
R7024:Lamb2	UTSW	9	108489488	missense	probably benign	0.00
R7116:Lamb2	UTSW	9	108487323	missense	probably damaging	1.00
R7146:Lamb2	UTSW	9	108484084	missense	possibly damaging	0.94
R7261:Lamb2	UTSW	9	108481297	missense	probably damaging	1.00
R7288:Lamb2	UTSW	9	108488324	missense	probably benign	0.20
R7404:Lamb2	UTSW	9	108487583	missense	probably damaging	1.00
R7456:Lamb2	UTSW	9	108485780	missense	possibly damaging	0.95
R7472:Lamb2	UTSW	9	108486148	missense	probably benign	0.01
R7623:Lamb2	UTSW	9	108489224	missense	possibly damaging	0.62
R8125:Lamb2	UTSW	9	108487523	missense	probably benign
R8153:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8154:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8155:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8156:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8157:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8419:Lamb2	UTSW	9	108488364	missense	probably benign	0.00
R8695:Lamb2	UTSW	9	108486166	missense	probably benign	0.08
R8825:Lamb2	UTSW	9	108485261	missense	probably benign	0.01
R9005:Lamb2	UTSW	9	108484171	critical splice donor site	probably null
R9315:Lamb2	UTSW	9	108487167	missense	possibly damaging	0.77
R9398:Lamb2	UTSW	9	108487167	missense	possibly damaging	0.77
R9419:Lamb2	UTSW	9	108479760	missense	unknown
R9450:Lamb2	UTSW	9	108480561	nonsense	probably null
R9495:Lamb2	UTSW	9	108480807	missense	probably damaging	1.00
R9514:Lamb2	UTSW	9	108480807	missense	probably damaging	1.00
R9529:Lamb2	UTSW	9	108486278	missense	probably benign	0.05
R9532:Lamb2	UTSW	9	108488631	missense	probably damaging	1.00
R9534:Lamb2	UTSW	9	108488631	missense	probably damaging	1.00
R9734:Lamb2	UTSW	9	108488631	missense	probably damaging	1.00
Z1176:Lamb2	UTSW	9	108482901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTGACCTGTGCTGACATTC -3'
(R):5'- TTACGCCACTGCAACTGTCACC -3'

Sequencing Primer
(F):5'- ACATTCTGGGTGTGGAAGC -3'
(R):5'- ACCATCATAAGGCTGTTTCGG -3'

Posted On

2013-06-12