Incidental Mutation 'R6178:Robo4'
ID487881
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 044320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R6178 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 37405630 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 414 (Q414*)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]
Predicted Effect probably null
Transcript: ENSMUST00000102895
AA Change: Q414*
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: Q414*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115046
AA Change: Q414*
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: Q414*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115048
AA Change: Q303*
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: Q303*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect probably null
Transcript: ENSMUST00000214185
AA Change: Q414*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mau2 A G 8: 70,042,537 I50T probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Naa16 T C 14: 79,383,340 I100V possibly damaging Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tbr1 T A 2: 61,804,815 D36E possibly damaging Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tgfb1i1 T C 7: 128,253,345 F478L probably damaging Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zfp65 G A 13: 67,710,318 P76S probably benign Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R8079:Robo4 UTSW 9 37402635 missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37405640 missense probably damaging 0.99
R8280:Robo4 UTSW 9 37404076 missense probably benign 0.00
R8526:Robo4 UTSW 9 37403505 nonsense probably null
R8547:Robo4 UTSW 9 37404378 missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37408281 missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37405834 missense unknown
Predicted Primers PCR Primer
(F):5'- CCACTTGTCCTGGGTGTAATG -3'
(R):5'- TCGTGCTGATTGCTCCATGG -3'

Sequencing Primer
(F):5'- GTCCTGGGTGTAATGTAACAGATTAC -3'
(R):5'- GATTGCTCCATGGCCTGC -3'
Posted On2017-10-10