Incidental Mutation 'R6178:Zfp65'
ID487892
Institutional Source Beutler Lab
Gene Symbol Zfp65
Ensembl Gene ENSMUSG00000071281
Gene Namezinc finger protein 65
SynonymsZfp71-rs1, KRAB5
MMRRC Submission 044320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6178 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67705309-67729173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67710318 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 76 (P76S)
Ref Sequence ENSEMBL: ENSMUSP00000153058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073157] [ENSMUST00000127979] [ENSMUST00000130891] [ENSMUST00000223829]
Predicted Effect probably benign
Transcript: ENSMUST00000073157
AA Change: P76S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072900
Gene: ENSMUSG00000071281
AA Change: P76S

DomainStartEndE-ValueType
KRAB 5 65 9.17e-32 SMART
ZnF_C2H2 81 101 1.05e1 SMART
ZnF_C2H2 109 131 8.4e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 5.99e-4 SMART
ZnF_C2H2 193 215 1.56e-2 SMART
ZnF_C2H2 221 243 1.95e-3 SMART
ZnF_C2H2 249 271 4.79e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 8.22e-2 SMART
ZnF_C2H2 333 355 5.9e-3 SMART
ZnF_C2H2 361 383 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127979
AA Change: P73S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117218
Gene: ENSMUSG00000071281
AA Change: P73S

DomainStartEndE-ValueType
KRAB 2 62 9.17e-32 SMART
ZnF_C2H2 78 98 1.05e1 SMART
ZnF_C2H2 106 128 8.4e1 SMART
ZnF_C2H2 134 156 3.58e-2 SMART
ZnF_C2H2 162 184 5.99e-4 SMART
ZnF_C2H2 190 212 1.56e-2 SMART
ZnF_C2H2 218 240 1.95e-3 SMART
ZnF_C2H2 246 268 4.79e-3 SMART
ZnF_C2H2 274 296 3.63e-3 SMART
ZnF_C2H2 302 324 8.22e-2 SMART
ZnF_C2H2 330 352 5.9e-3 SMART
ZnF_C2H2 358 380 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130891
AA Change: P86S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123380
Gene: ENSMUSG00000071281
AA Change: P86S

DomainStartEndE-ValueType
KRAB 15 75 9.17e-32 SMART
ZnF_C2H2 91 111 1.05e1 SMART
ZnF_C2H2 119 141 8.4e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 5.99e-4 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 231 253 1.95e-3 SMART
ZnF_C2H2 259 281 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223829
AA Change: P76S

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mau2 A G 8: 70,042,537 I50T probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Naa16 T C 14: 79,383,340 I100V possibly damaging Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Robo4 C T 9: 37,405,630 Q414* probably null Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tbr1 T A 2: 61,804,815 D36E possibly damaging Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tgfb1i1 T C 7: 128,253,345 F478L probably damaging Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in Zfp65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Zfp65 APN 13 67708185 missense possibly damaging 0.92
IGL02563:Zfp65 APN 13 67708065 missense possibly damaging 0.88
R2142:Zfp65 UTSW 13 67708192 missense probably damaging 1.00
R2169:Zfp65 UTSW 13 67710380 missense probably damaging 1.00
R4702:Zfp65 UTSW 13 67724222 start codon destroyed probably null 0.98
R4770:Zfp65 UTSW 13 67708358 missense probably damaging 1.00
R4836:Zfp65 UTSW 13 67708875 missense probably benign 0.15
R4943:Zfp65 UTSW 13 67710980 missense probably damaging 0.99
R5229:Zfp65 UTSW 13 67708810 missense probably benign 0.02
R6786:Zfp65 UTSW 13 67708011 missense probably damaging 1.00
R6991:Zfp65 UTSW 13 67708521 missense probably damaging 0.97
R7896:Zfp65 UTSW 13 67729055 splice site probably null
R8376:Zfp65 UTSW 13 67708918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACACAAGTTAATCTCATAGTGG -3'
(R):5'- TGGTGTGCCCATCAGAAAACATG -3'

Sequencing Primer
(F):5'- TCTCATAGTGGAAGAAAACAAAGC -3'
(R):5'- GCCCATCAGAAAACATGTGAAAAATG -3'
Posted On2017-10-10