Incidental Mutation 'R6178:Naa16'
ID 487895
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene Name N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms Narg1l, 1300019C06Rik
MMRRC Submission 044320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R6178 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 79325269-79390778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79383340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000022597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486] [ENSMUST00000169500]
AlphaFold Q9DBB4
Predicted Effect possibly damaging
Transcript: ENSMUST00000022597
AA Change: I100V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: I100V

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163486
AA Change: I66V

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: I66V

DomainStartEndE-ValueType
TPR 12 45 2.99e1 SMART
TPR 46 79 2.98e-3 SMART
Blast:TPR 190 223 3e-10 BLAST
TPR 340 373 9.96e0 SMART
TPR 374 407 7.47e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165337
Predicted Effect probably benign
Transcript: ENSMUST00000169500
SMART Domains Protein: ENSMUSP00000127298
Gene: ENSMUSG00000022020

DomainStartEndE-ValueType
PDB:4KVO|D 1 46 1e-6 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mau2 A G 8: 70,042,537 I50T probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Robo4 C T 9: 37,405,630 Q414* probably null Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tbr1 T A 2: 61,804,815 D36E possibly damaging Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tgfb1i1 T C 7: 128,253,345 F478L probably damaging Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zfp65 G A 13: 67,710,318 P76S probably benign Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1674:Naa16 UTSW 14 79387057 start codon destroyed probably null 0.65
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4638:Naa16 UTSW 14 79340033 splice site probably null
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6960:Naa16 UTSW 14 79359471 missense possibly damaging 0.65
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8892:Naa16 UTSW 14 79390576 missense probably benign 0.32
R8931:Naa16 UTSW 14 79344955 missense probably damaging 1.00
R9010:Naa16 UTSW 14 79370042 missense probably benign 0.01
R9068:Naa16 UTSW 14 79374849 missense probably benign 0.18
R9360:Naa16 UTSW 14 79356503 missense probably benign 0.05
R9688:Naa16 UTSW 14 79335869 nonsense probably null
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACACACCTTCAATCCCATTA -3'
(R):5'- TTACAAAAGCAAGGGAATTGAATGTA -3'

Sequencing Primer
(F):5'- CCAGATCACATTGCAGATGGTCG -3'
(R):5'- CCAGCTGACTAGTCAAGGGTTG -3'
Posted On 2017-10-10