Mutagenetix > Incidental Mutation

Incidental Mutation 'R6178:Celsr1'

487899

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

Scy, Adgrc1, Crsh, crash

MMRRC Submission

044320-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.634) question?

Stock #

R6178 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85783130-85918404 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85785222 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Methionine at position 3004 (R3004M)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000023019]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000016172
AA Change: R3004M

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: R3004M

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000023019

SMART Domains

Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386

Domain	Start	End	E-Value	Type
Pfam:NAD_synthase	1	133	7.7e-7	PFAM
Pfam:ThiI	3	79	7.7e-8	PFAM
Pfam:tRNA_Me_trans	5	383	3.4e-142	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159362

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162010

Predicted Effect

probably benign
Transcript: ENSMUST00000162339

SMART Domains

Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

Domain	Start	End	E-Value	Type
Pfam:tRNA_Me_trans	1	46	1.1e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226204

Predicted Effect

unknown
Transcript: ENSMUST00000226840
AA Change: R1636M

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 45,678,468 (GRCm39)	I61V	probably benign	Het
Afg3l2	G	A	18: 67,542,598 (GRCm39)	T616I	possibly damaging	Het
Aktip	T	C	8: 91,852,671 (GRCm39)	N195S	probably damaging	Het
Ankfy1	G	A	11: 72,645,285 (GRCm39)	C788Y	probably benign	Het
Atg7	T	A	6: 114,701,856 (GRCm39)	I621N	probably damaging	Het
Becn1	T	A	11: 101,182,336 (GRCm39)	I283F	probably damaging	Het
Btnl12	T	C	16: 37,676,422 (GRCm39)	Y115C	probably damaging	Het
C4b	T	C	17: 34,952,380 (GRCm39)	T1220A	probably benign	Het
Clspn	A	T	4: 126,471,529 (GRCm39)		probably null	Het
Csmd3	T	C	15: 48,536,854 (GRCm39)	Y116C	probably damaging	Het
Dcp1a	T	G	14: 30,245,261 (GRCm39)	*603G	probably null	Het
Dmrtc1b	C	T	X: 101,757,169 (GRCm39)	P205S	possibly damaging	Het
Fev	G	T	1: 74,923,698 (GRCm39)		probably benign	Het
Fry	T	A	5: 150,377,987 (GRCm39)	V393E	probably damaging	Het
Gm30646	A	G	7: 30,132,081 (GRCm39)		probably null	Het
Gm3676	C	T	14: 41,363,452 (GRCm39)	E175K	probably benign	Het
Gm4847	T	C	1: 166,469,905 (GRCm39)	Y56C	probably damaging	Het
Gm5422	T	C	10: 31,125,688 (GRCm39)		noncoding transcript	Het
Gstm6	A	G	3: 107,848,397 (GRCm39)	V174A	probably benign	Het
Isoc1	G	T	18: 58,804,664 (GRCm39)	V191F	possibly damaging	Het
Kalrn	T	A	16: 33,874,009 (GRCm39)	D132V	possibly damaging	Het
Kcp	T	C	6: 29,482,887 (GRCm39)	D1394G	possibly damaging	Het
Marchf10	T	G	11: 105,280,440 (GRCm39)	D615A	probably damaging	Het
Mau2	A	G	8: 70,495,187 (GRCm39)	I50T	probably damaging	Het
Mgp	A	G	6: 136,849,722 (GRCm39)	C79R	probably damaging	Het
Mpdz	T	A	4: 81,226,602 (GRCm39)	K1344N	probably damaging	Het
Mrgpre	T	A	7: 143,334,708 (GRCm39)	Y265F	possibly damaging	Het
Mro	G	A	18: 74,006,295 (GRCm39)	V80M	possibly damaging	Het
Mrpl44	G	T	1: 79,755,895 (GRCm39)	C167F	possibly damaging	Het
Muc5b	A	G	7: 141,410,079 (GRCm39)	M1218V	probably null	Het
Naa16	T	C	14: 79,620,780 (GRCm39)	I100V	possibly damaging	Het
Nup205	A	T	6: 35,220,778 (GRCm39)	Y1860F	possibly damaging	Het
Or10aa3	A	T	1: 173,878,533 (GRCm39)	Y198F	probably benign	Het
Or14c40	A	G	7: 86,313,819 (GRCm39)	I316M	probably benign	Het
Or1e16	AGCGGTCGTAGGC	AGC	11: 73,286,480 (GRCm39)		probably null	Het
Or4c103	T	C	2: 88,513,977 (GRCm39)	Y33C	probably damaging	Het
Plcb3	A	G	19: 6,932,071 (GRCm39)		probably null	Het
Pnpla3	G	A	15: 84,065,132 (GRCm39)	A309T	probably benign	Het
Ranbp10	A	G	8: 106,498,296 (GRCm39)	S624P	possibly damaging	Het
Ripor2	T	C	13: 24,894,113 (GRCm39)	S714P	possibly damaging	Het
Robo4	C	T	9: 37,316,926 (GRCm39)	Q414*	probably null	Het
Shc2	A	G	10: 79,465,954 (GRCm39)	I161T	probably damaging	Het
Slc35b2	C	T	17: 45,877,302 (GRCm39)	T143I	probably benign	Het
Slc39a13	T	C	2: 90,898,880 (GRCm39)	D77G	probably damaging	Het
Snx6	A	C	12: 54,807,249 (GRCm39)	D243E	probably damaging	Het
Taar8b	A	G	10: 23,967,711 (GRCm39)	V161A	probably benign	Het
Tbr1	T	A	2: 61,635,159 (GRCm39)	D36E	possibly damaging	Het
Tdpoz2	T	C	3: 93,559,618 (GRCm39)	N118S	probably benign	Het
Tgfb1i1	T	C	7: 127,852,517 (GRCm39)	F478L	probably damaging	Het
Tmprss11f	T	C	5: 86,704,837 (GRCm39)	D27G	probably benign	Het
Trim30d	T	G	7: 104,137,202 (GRCm39)	M1L	probably damaging	Het
Trpm7	A	G	2: 126,679,301 (GRCm39)	V420A	probably damaging	Het
Ubap2	G	T	4: 41,206,981 (GRCm39)	P199H	probably benign	Het
Ubash3b	T	C	9: 40,926,212 (GRCm39)	T512A	probably damaging	Het
Zfp65	G	A	13: 67,858,437 (GRCm39)	P76S	probably benign	Het
Zic5	A	T	14: 122,696,748 (GRCm39)	H622Q	unknown	Het
Zpld1	A	T	16: 55,053,993 (GRCm39)	N266K	probably damaging	Het
Zswim1	A	G	2: 164,667,972 (GRCm39)		probably null	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85,815,546 (GRCm39)	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	85,915,037 (GRCm39)	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85,806,436 (GRCm39)	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	85,914,692 (GRCm39)	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85,810,391 (GRCm39)	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85,814,096 (GRCm39)	missense	probably benign
IGL01931:Celsr1	APN	15	85,791,861 (GRCm39)	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85,847,424 (GRCm39)	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85,791,922 (GRCm39)	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85,863,205 (GRCm39)	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85,814,108 (GRCm39)	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	85,915,427 (GRCm39)	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85,825,337 (GRCm39)	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85,784,889 (GRCm39)	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	85,914,818 (GRCm39)	nonsense	probably null
IGL02899:Celsr1	APN	15	85,915,927 (GRCm39)	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85,785,673 (GRCm39)	missense	probably benign
IGL03212:Celsr1	APN	15	85,814,878 (GRCm39)	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85,806,436 (GRCm39)	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85,785,138 (GRCm39)	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	85,916,615 (GRCm39)	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	85,915,243 (GRCm39)	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	85,915,243 (GRCm39)	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85,813,620 (GRCm39)	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	85,914,963 (GRCm39)	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85,806,399 (GRCm39)	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85,806,399 (GRCm39)	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85,787,065 (GRCm39)	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85,787,566 (GRCm39)	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85,816,524 (GRCm39)	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85,785,798 (GRCm39)	missense	probably benign
R0792:Celsr1	UTSW	15	85,815,477 (GRCm39)	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85,787,489 (GRCm39)	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	85,915,480 (GRCm39)	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	85,916,248 (GRCm39)	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85,788,175 (GRCm39)	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85,863,347 (GRCm39)	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85,789,635 (GRCm39)	splice site	probably null
R1405:Celsr1	UTSW	15	85,789,635 (GRCm39)	splice site	probably null
R1522:Celsr1	UTSW	15	85,815,477 (GRCm39)	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	85,915,263 (GRCm39)	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85,816,658 (GRCm39)	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	85,914,524 (GRCm39)	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	85,916,886 (GRCm39)	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	85,916,960 (GRCm39)	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	85,917,088 (GRCm39)	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	85,914,748 (GRCm39)	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85,847,424 (GRCm39)	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	85,916,168 (GRCm39)	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85,863,431 (GRCm39)	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85,800,924 (GRCm39)	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	85,916,008 (GRCm39)	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85,863,028 (GRCm39)	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85,812,200 (GRCm39)	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85,847,334 (GRCm39)	missense	probably benign	0.00
R4416:Celsr1	UTSW	15	85,812,200 (GRCm39)	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85,800,957 (GRCm39)	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	85,914,695 (GRCm39)	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85,816,661 (GRCm39)	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85,790,230 (GRCm39)	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85,822,154 (GRCm39)	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85,822,112 (GRCm39)	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85,823,335 (GRCm39)	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85,816,585 (GRCm39)	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85,814,747 (GRCm39)	missense	probably benign
R5310:Celsr1	UTSW	15	85,810,423 (GRCm39)	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85,809,719 (GRCm39)	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85,815,483 (GRCm39)	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	85,914,968 (GRCm39)	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85,825,465 (GRCm39)	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	85,917,156 (GRCm39)	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85,788,215 (GRCm39)	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85,914,550 (GRCm39)	missense	probably damaging	0.96
R5915:Celsr1	UTSW	15	85,822,176 (GRCm39)	missense	probably benign
R5932:Celsr1	UTSW	15	85,916,905 (GRCm39)	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	85,916,701 (GRCm39)	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85,803,239 (GRCm39)	splice site	probably null
R6050:Celsr1	UTSW	15	85,814,812 (GRCm39)	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85,816,612 (GRCm39)	missense	probably benign	0.04
R6186:Celsr1	UTSW	15	85,805,394 (GRCm39)	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85,800,888 (GRCm39)	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85,812,531 (GRCm39)	missense	probably benign
R6320:Celsr1	UTSW	15	85,785,160 (GRCm39)	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	85,915,885 (GRCm39)	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85,809,719 (GRCm39)	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85,863,121 (GRCm39)	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85,847,486 (GRCm39)	missense	probably benign
R6615:Celsr1	UTSW	15	85,786,315 (GRCm39)	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85,803,135 (GRCm39)	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85,790,115 (GRCm39)	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85,791,799 (GRCm39)	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	85,915,696 (GRCm39)	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	85,914,983 (GRCm39)	missense	probably benign
R6838:Celsr1	UTSW	15	85,823,395 (GRCm39)	missense	probably benign
R6886:Celsr1	UTSW	15	85,915,855 (GRCm39)	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85,789,679 (GRCm39)	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	85,916,856 (GRCm39)	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85,816,652 (GRCm39)	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	85,917,209 (GRCm39)	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	85,914,715 (GRCm39)	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	85,914,875 (GRCm39)	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85,791,874 (GRCm39)	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	85,917,593 (GRCm39)	missense	probably benign
R7491:Celsr1	UTSW	15	85,916,719 (GRCm39)	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85,814,073 (GRCm39)	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85,862,933 (GRCm39)	nonsense	probably null
R7741:Celsr1	UTSW	15	85,863,303 (GRCm39)	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85,816,610 (GRCm39)	missense	probably benign
R7974:Celsr1	UTSW	15	85,915,231 (GRCm39)	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	85,917,194 (GRCm39)	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	85,917,194 (GRCm39)	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85,823,356 (GRCm39)	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	85,915,801 (GRCm39)	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85,787,090 (GRCm39)	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85,863,436 (GRCm39)	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8290:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8292:Celsr1	UTSW	15	85,791,819 (GRCm39)	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85,806,445 (GRCm39)	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85,816,501 (GRCm39)	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	85,915,615 (GRCm39)	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8384:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8452:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8463:Celsr1	UTSW	15	85,914,415 (GRCm39)	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8480:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8493:Celsr1	UTSW	15	85,822,207 (GRCm39)	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85,823,306 (GRCm39)	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R8771:Celsr1	UTSW	15	85,788,175 (GRCm39)	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85,822,194 (GRCm39)	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85,788,269 (GRCm39)	intron	probably benign
R8924:Celsr1	UTSW	15	85,916,671 (GRCm39)	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85,847,340 (GRCm39)	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	85,914,772 (GRCm39)	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85,803,217 (GRCm39)	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9196:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9198:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9200:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9201:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9202:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9203:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9222:Celsr1	UTSW	15	85,815,471 (GRCm39)	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	85,915,051 (GRCm39)	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9386:Celsr1	UTSW	15	85,863,231 (GRCm39)	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9401:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9415:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9428:Celsr1	UTSW	15	85,815,549 (GRCm39)	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85,806,535 (GRCm39)	splice site	probably benign
R9493:Celsr1	UTSW	15	85,785,346 (GRCm39)	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9499:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
R9607:Celsr1	UTSW	15	85,915,229 (GRCm39)	missense
R9673:Celsr1	UTSW	15	85,917,286 (GRCm39)	nonsense	probably null
Z1176:Celsr1	UTSW	15	85,847,301 (GRCm39)	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85,863,052 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTGGCAACTGCATGAATC -3'
(R):5'- ACTGACTAGGTGGTTATCCCC -3'

Sequencing Primer
(F):5'- ATCCAAAGTCATTCTCGGGG -3'
(R):5'- GACTAGGTGGTTATCCCCCTTCTC -3'

Posted On

2017-10-10