Mutagenetix > Incidental Mutations

Incidental Mutation 'R6178:Afg3l2'

487906

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

044320-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6178 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 67409528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 616 (T616I)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025408
AA Change: T616I

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: T616I

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,029,044	I61V	probably benign	Het
Aktip	T	C	8: 91,126,043	N195S	probably damaging	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Atg7	T	A	6: 114,724,895	I621N	probably damaging	Het
Becn1	T	A	11: 101,291,510	I283F	probably damaging	Het
C4b	T	C	17: 34,733,406	T1220A	probably benign	Het
Celsr1	C	A	15: 85,901,021	R3004M	probably benign	Het
Clspn	A	T	4: 126,577,736		probably null	Het
Csmd3	T	C	15: 48,673,458	Y116C	probably damaging	Het
Dcp1a	T	G	14: 30,523,304	*603G	probably null	Het
Dmrtc1b	C	T	X: 102,713,563	P205S	possibly damaging	Het
Fev	G	T	1: 74,884,539		probably benign	Het
Fry	T	A	5: 150,454,522	V393E	probably damaging	Het
Gm30646	A	G	7: 30,432,656		probably null	Het
Gm36028	T	C	16: 37,856,060	Y115C	probably damaging	Het
Gm3676	C	T	14: 41,641,495	E175K	probably benign	Het
Gm4847	T	C	1: 166,642,336	Y56C	probably damaging	Het
Gm5422	T	C	10: 31,249,692		noncoding transcript	Het
Gstm6	A	G	3: 107,941,081	V174A	probably benign	Het
Isoc1	G	T	18: 58,671,592	V191F	possibly damaging	Het
Kalrn	T	A	16: 34,053,639	D132V	possibly damaging	Het
Kcp	T	C	6: 29,482,888	D1394G	possibly damaging	Het
March10	T	G	11: 105,389,614	D615A	probably damaging	Het
Mau2	A	G	8: 70,042,537	I50T	probably damaging	Het
Mgp	A	G	6: 136,872,724	C79R	probably damaging	Het
Mpdz	T	A	4: 81,308,365	K1344N	probably damaging	Het
Mrgpre	T	A	7: 143,780,971	Y265F	possibly damaging	Het
Mro	G	A	18: 73,873,224	V80M	possibly damaging	Het
Mrpl44	G	T	1: 79,778,178	C167F	possibly damaging	Het
Muc5b	A	G	7: 141,856,342	M1218V	probably null	Het
Naa16	T	C	14: 79,383,340	I100V	possibly damaging	Het
Nup205	A	T	6: 35,243,843	Y1860F	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1195	T	C	2: 88,683,633	Y33C	probably damaging	Het
Olfr293	A	G	7: 86,664,611	I316M	probably benign	Het
Olfr432	A	T	1: 174,050,967	Y198F	probably benign	Het
Plcb3	A	G	19: 6,954,703		probably null	Het
Pnpla3	G	A	15: 84,180,931	A309T	probably benign	Het
Ranbp10	A	G	8: 105,771,664	S624P	possibly damaging	Het
Ripor2	T	C	13: 24,710,130	S714P	possibly damaging	Het
Robo4	C	T	9: 37,405,630	Q414*	probably null	Het
Shc2	A	G	10: 79,630,120	I161T	probably damaging	Het
Slc35b2	C	T	17: 45,566,376	T143I	probably benign	Het
Slc39a13	T	C	2: 91,068,535	D77G	probably damaging	Het
Snx6	A	C	12: 54,760,464	D243E	probably damaging	Het
Taar8b	A	G	10: 24,091,813	V161A	probably benign	Het
Tbr1	T	A	2: 61,804,815	D36E	possibly damaging	Het
Tdpoz2	T	C	3: 93,652,311	N118S	probably benign	Het
Tgfb1i1	T	C	7: 128,253,345	F478L	probably damaging	Het
Tmprss11f	T	C	5: 86,556,978	D27G	probably benign	Het
Trim30d	T	G	7: 104,487,995	M1L	probably damaging	Het
Trpm7	A	G	2: 126,837,381	V420A	probably damaging	Het
Ubap2	G	T	4: 41,206,981	P199H	probably benign	Het
Ubash3b	T	C	9: 41,014,916	T512A	probably damaging	Het
Zfp65	G	A	13: 67,710,318	P76S	probably benign	Het
Zic5	A	T	14: 122,459,336	H622Q	unknown	Het
Zpld1	A	T	16: 55,233,630	N266K	probably damaging	Het
Zswim1	A	G	2: 164,826,052		probably null	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TGCAAAGGCTGATTCCCAGG -3'
(R):5'- ACGTGCTTTCTGGGCCTAAC -3'

Sequencing Primer
(F):5'- CTGATTCCCAGGCAGGTAAG -3'
(R):5'- CTTTCTGGGCCTAACTCGGG -3'

Posted On

2017-10-10