Mutagenetix > Incidental Mutations

Incidental Mutation 'R6179:Olfr350'

487914

Institutional Source

Beutler Lab

Gene Symbol

Olfr350

Ensembl Gene

ENSMUSG00000050015

Gene Name

olfactory receptor 350

Synonyms

MOR136-13, GA_x6K02T2NLDC-33544602-33545540

MMRRC Submission

044321-MU

Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R6179 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36846310-36851702 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36850834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 263 (S263P)

Ref Sequence

ENSEMBL: ENSMUSP00000149667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]

AlphaFold

Q8VFP8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055130
AA Change: S263P

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: S263P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	6.3e-61	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.3e-7	PFAM
Pfam:7tm_1	41	290	3e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214457
AA Change: S263P

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215100
AA Change: S263P

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930426L09Rik	T	C	2: 18,998,842		probably benign	Het
4930590J08Rik	T	C	6: 91,942,330	S657P	probably damaging	Het
Abca9	T	C	11: 110,134,254	I988V	probably benign	Het
Aox4	T	A	1: 58,231,503	D280E	probably benign	Het
Apob	T	A	12: 8,005,060	L1353*	probably null	Het
Atp2b1	C	T	10: 99,022,829	R222C	probably damaging	Het
AW209491	T	G	13: 14,637,083	S174A	possibly damaging	Het
B930094E09Rik	G	C	18: 31,609,858		probably benign	Het
Cbln3	G	T	14: 55,884,060	P43Q	possibly damaging	Het
Ccdc181	A	T	1: 164,279,918	T57S	probably benign	Het
Ccr2	A	C	9: 124,105,971	N96T	probably damaging	Het
Cep131	T	C	11: 120,066,011	I868V	probably benign	Het
Chd2	A	G	7: 73,444,323	I1535T	probably damaging	Het
Chl1	A	T	6: 103,683,243	T377S	probably benign	Het
Cpeb3	A	G	19: 37,088,453	F439L	probably damaging	Het
Crb2	T	C	2: 37,790,257	V399A	probably damaging	Het
Cry2	C	T	2: 92,413,842	G329R	probably damaging	Het
Dock4	A	G	12: 40,731,869	E691G	probably benign	Het
Edil3	A	T	13: 88,821,989	H3L	probably benign	Het
Endod1	T	C	9: 14,357,461	I243V	probably benign	Het
Fpr3	G	A	17: 17,970,657	W63*	probably null	Het
Gm498	A	G	7: 143,871,787	T58A	probably benign	Het
Gtse1	T	G	15: 85,868,957	N424K	possibly damaging	Het
Kcnt1	G	A	2: 25,893,180	V252M	probably damaging	Het
Kif1bp	G	A	10: 62,563,250	Q130*	probably null	Het
Lmbrd2	T	G	15: 9,149,175	I48M	probably damaging	Het
Lrrc7	T	G	3: 158,353,432	I13L	probably damaging	Het
Mbd4	A	G	6: 115,845,425	S408P	probably benign	Het
Mphosph10	A	G	7: 64,378,781	V542A	possibly damaging	Het
Msto1	C	A	3: 88,910,947	R331L	probably damaging	Het
Myh10	G	A	11: 68,802,153	E1425K	probably damaging	Het
Nup43	T	C	10: 7,678,673	I340T	probably benign	Het
Pcm1	T	A	8: 41,283,632	M884K	probably damaging	Het
Phf20	T	A	2: 156,298,653	L749H	probably damaging	Het
Pigp	T	C	16: 94,370,367	R22G	probably null	Het
Polr2b	T	C	5: 77,320,977	M200T	probably damaging	Het
Ppig	T	A	2: 69,750,127	D668E	unknown	Het
Prss3	G	A	6: 41,375,126	R68C	probably benign	Het
Retreg3	G	A	11: 101,103,895		probably benign	Het
Shank1	T	C	7: 44,357,206	F2116L	possibly damaging	Het
Spg21	T	C	9: 65,468,808	S33P	possibly damaging	Het
Spns3	A	G	11: 72,499,523	S432P	probably damaging	Het
Stra6	A	G	9: 58,135,169	E27G	probably damaging	Het
Tanc1	A	G	2: 59,842,976	Q1468R	probably benign	Het
Tbce	T	G	13: 14,019,777	E99A	probably benign	Het
Tmem106b	T	C	6: 13,084,253	V252A	probably damaging	Het
Trim10	A	G	17: 36,877,031	T380A	probably damaging	Het
Trim31	T	A	17: 36,909,609	D472E	probably damaging	Het
Vmn2r28	G	A	7: 5,488,004	Q415*	probably null	Het
Vwf	G	A	6: 125,649,289	C7Y	unknown	Het
Yeats2	C	T	16: 20,214,475	P1088L	probably benign	Het
Zfp40	C	A	17: 23,178,380	V48L	possibly damaging	Het

Other mutations in Olfr350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Olfr350	APN	2	36850270	missense	probably damaging	1.00
IGL01113:Olfr350	APN	2	36850619	missense	probably damaging	1.00
IGL01393:Olfr350	APN	2	36850541	missense	probably benign	0.01
IGL02302:Olfr350	APN	2	36850703	missense	probably benign	0.02
IGL02316:Olfr350	APN	2	36850282	missense	probably damaging	1.00
BB007:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
BB017:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
F6893:Olfr350	UTSW	2	36850807	missense	probably benign	0.00
PIT4402001:Olfr350	UTSW	2	36850304	missense	probably benign
R0312:Olfr350	UTSW	2	36850360	missense	probably benign	0.01
R0525:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R0557:Olfr350	UTSW	2	36850748	missense	possibly damaging	0.95
R0665:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R2019:Olfr350	UTSW	2	36850406	missense	possibly damaging	0.95
R2107:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2108:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2848:Olfr350	UTSW	2	36850799	missense	probably damaging	1.00
R3964:Olfr350	UTSW	2	36850717	missense	probably benign	0.12
R4822:Olfr350	UTSW	2	36850876	missense	probably benign	0.10
R4907:Olfr350	UTSW	2	36850258	missense	probably benign	0.28
R5134:Olfr350	UTSW	2	36850476	missense	probably benign	0.03
R5144:Olfr350	UTSW	2	36850144	missense	probably benign
R5702:Olfr350	UTSW	2	36850934	missense	probably damaging	1.00
R5727:Olfr350	UTSW	2	36850532	missense	possibly damaging	0.80
R5786:Olfr350	UTSW	2	36850049	start codon destroyed	probably null	0.98
R6862:Olfr350	UTSW	2	36850222	missense	possibly damaging	0.95
R7258:Olfr350	UTSW	2	36850340	missense	probably damaging	0.99
R7307:Olfr350	UTSW	2	36850125	missense	probably benign	0.00
R7353:Olfr350	UTSW	2	36850069	missense	probably benign
R7412:Olfr350	UTSW	2	36850466	missense	probably benign	0.28
R7851:Olfr350	UTSW	2	36850416	nonsense	probably null
R7930:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
R8005:Olfr350	UTSW	2	36850144	missense	probably benign
R8346:Olfr350	UTSW	2	36850339	missense	probably benign	0.02
R8692:Olfr350	UTSW	2	36850084	missense	probably benign	0.00
R9120:Olfr350	UTSW	2	36850131	nonsense	probably null
R9318:Olfr350	UTSW	2	36850553	missense	probably benign	0.12
Z1177:Olfr350	UTSW	2	36850239	missense	probably damaging	0.99
Z1177:Olfr350	UTSW	2	36850925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTACAACAGTCATTACTCTGC -3'
(R):5'- TGCTCCATAATGAGACCACAAATG -3'

Sequencing Primer
(F):5'- ACAGTCATTACTCTGCCATTAATATG -3'
(R):5'- CACAAATGGAAGTGTAATATTTGGAG -3'

Posted On

2017-10-10