Mutagenetix > Incidental Mutations

Incidental Mutation 'R6179:Chl1'

487926

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

044321-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.473) question?

Stock #

R6179 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103683243 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 377 (T377S)

Ref Sequence

ENSEMBL: ENSMUSP00000145026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912]

Predicted Effect

probably benign
Transcript: ENSMUST00000066905
AA Change: T361S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: T361S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203830
AA Change: T361S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: T361S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203912
AA Change: T377S

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: T377S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930426L09Rik	T	C	2: 18,998,842		probably benign	Het
4930590J08Rik	T	C	6: 91,942,330	S657P	probably damaging	Het
Abca9	T	C	11: 110,134,254	I988V	probably benign	Het
Aox4	T	A	1: 58,231,503	D280E	probably benign	Het
Apob	T	A	12: 8,005,060	L1353*	probably null	Het
Atp2b1	C	T	10: 99,022,829	R222C	probably damaging	Het
AW209491	T	G	13: 14,637,083	S174A	possibly damaging	Het
B930094E09Rik	G	C	18: 31,609,858		probably benign	Het
Cbln3	G	T	14: 55,884,060	P43Q	possibly damaging	Het
Ccdc181	A	T	1: 164,279,918	T57S	probably benign	Het
Ccr2	A	C	9: 124,105,971	N96T	probably damaging	Het
Cep131	T	C	11: 120,066,011	I868V	probably benign	Het
Chd2	A	G	7: 73,444,323	I1535T	probably damaging	Het
Cpeb3	A	G	19: 37,088,453	F439L	probably damaging	Het
Crb2	T	C	2: 37,790,257	V399A	probably damaging	Het
Cry2	C	T	2: 92,413,842	G329R	probably damaging	Het
Dock4	A	G	12: 40,731,869	E691G	probably benign	Het
Edil3	A	T	13: 88,821,989	H3L	probably benign	Het
Endod1	T	C	9: 14,357,461	I243V	probably benign	Het
Fpr3	G	A	17: 17,970,657	W63*	probably null	Het
Gm498	A	G	7: 143,871,787	T58A	probably benign	Het
Gtse1	T	G	15: 85,868,957	N424K	possibly damaging	Het
Kcnt1	G	A	2: 25,893,180	V252M	probably damaging	Het
Kif1bp	G	A	10: 62,563,250	Q130*	probably null	Het
Lmbrd2	T	G	15: 9,149,175	I48M	probably damaging	Het
Lrrc7	T	G	3: 158,353,432	I13L	probably damaging	Het
Mbd4	A	G	6: 115,845,425	S408P	probably benign	Het
Mphosph10	A	G	7: 64,378,781	V542A	possibly damaging	Het
Msto1	C	A	3: 88,910,947	R331L	probably damaging	Het
Myh10	G	A	11: 68,802,153	E1425K	probably damaging	Het
Nup43	T	C	10: 7,678,673	I340T	probably benign	Het
Olfr350	T	C	2: 36,850,834	S263P	possibly damaging	Het
Pcm1	T	A	8: 41,283,632	M884K	probably damaging	Het
Phf20	T	A	2: 156,298,653	L749H	probably damaging	Het
Pigp	T	C	16: 94,370,367	R22G	probably null	Het
Polr2b	T	C	5: 77,320,977	M200T	probably damaging	Het
Ppig	T	A	2: 69,750,127	D668E	unknown	Het
Prss3	G	A	6: 41,375,126	R68C	probably benign	Het
Retreg3	G	A	11: 101,103,895		probably benign	Het
Shank1	T	C	7: 44,357,206	F2116L	possibly damaging	Het
Spg21	T	C	9: 65,468,808	S33P	possibly damaging	Het
Spns3	A	G	11: 72,499,523	S432P	probably damaging	Het
Stra6	A	G	9: 58,135,169	E27G	probably damaging	Het
Tanc1	A	G	2: 59,842,976	Q1468R	probably benign	Het
Tbce	T	G	13: 14,019,777	E99A	probably benign	Het
Tmem106b	T	C	6: 13,084,253	V252A	probably damaging	Het
Trim10	A	G	17: 36,877,031	T380A	probably damaging	Het
Trim31	T	A	17: 36,909,609	D472E	probably damaging	Het
Vmn2r28	G	A	7: 5,488,004	Q415*	probably null	Het
Vwf	G	A	6: 125,649,289	C7Y	unknown	Het
Yeats2	C	T	16: 20,214,475	P1088L	probably benign	Het
Zfp40	C	A	17: 23,178,380	V48L	possibly damaging	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AATACTTGGTAGTGTCTGCCCTC -3'
(R):5'- CACCTGGTGATTTTCTGGCAC -3'

Sequencing Primer
(F):5'- CTGCCCTCTGCTGGTTAAGG -3'
(R):5'- CTGGCACTGTATTATGCTAACACAG -3'

Posted On

2017-10-10