Incidental Mutation 'R6179:Nup43'
ID487939
Institutional Source Beutler Lab
Gene Symbol Nup43
Ensembl Gene ENSMUSG00000040034
Gene Namenucleoporin 43
Synonymsp42, 43kDa, 2610529I12Rik, 2610016K01Rik
MMRRC Submission 044321-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6179 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7667503-7678881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7678673 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 340 (I340T)
Ref Sequence ENSEMBL: ENSMUSP00000046732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040135] [ENSMUST00000159977] [ENSMUST00000162682] [ENSMUST00000165952]
Predicted Effect probably benign
Transcript: ENSMUST00000040135
AA Change: I340T

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046732
Gene: ENSMUSG00000040034
AA Change: I340T

DomainStartEndE-ValueType
Blast:WD40 1 48 1e-15 BLAST
WD40 64 101 3.57e0 SMART
WD40 124 157 2.45e2 SMART
WD40 160 199 9.55e0 SMART
WD40 206 246 2.15e-4 SMART
WD40 250 290 2.19e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162527
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165952
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP43 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930426L09Rik T C 2: 18,998,842 probably benign Het
4930590J08Rik T C 6: 91,942,330 S657P probably damaging Het
Abca9 T C 11: 110,134,254 I988V probably benign Het
Aox4 T A 1: 58,231,503 D280E probably benign Het
Apob T A 12: 8,005,060 L1353* probably null Het
Atp2b1 C T 10: 99,022,829 R222C probably damaging Het
AW209491 T G 13: 14,637,083 S174A possibly damaging Het
B930094E09Rik G C 18: 31,609,858 probably benign Het
Cbln3 G T 14: 55,884,060 P43Q possibly damaging Het
Ccdc181 A T 1: 164,279,918 T57S probably benign Het
Ccr2 A C 9: 124,105,971 N96T probably damaging Het
Cep131 T C 11: 120,066,011 I868V probably benign Het
Chd2 A G 7: 73,444,323 I1535T probably damaging Het
Chl1 A T 6: 103,683,243 T377S probably benign Het
Cpeb3 A G 19: 37,088,453 F439L probably damaging Het
Crb2 T C 2: 37,790,257 V399A probably damaging Het
Cry2 C T 2: 92,413,842 G329R probably damaging Het
Dock4 A G 12: 40,731,869 E691G probably benign Het
Edil3 A T 13: 88,821,989 H3L probably benign Het
Endod1 T C 9: 14,357,461 I243V probably benign Het
Fpr3 G A 17: 17,970,657 W63* probably null Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gtse1 T G 15: 85,868,957 N424K possibly damaging Het
Kcnt1 G A 2: 25,893,180 V252M probably damaging Het
Kif1bp G A 10: 62,563,250 Q130* probably null Het
Lmbrd2 T G 15: 9,149,175 I48M probably damaging Het
Lrrc7 T G 3: 158,353,432 I13L probably damaging Het
Mbd4 A G 6: 115,845,425 S408P probably benign Het
Mphosph10 A G 7: 64,378,781 V542A possibly damaging Het
Msto1 C A 3: 88,910,947 R331L probably damaging Het
Myh10 G A 11: 68,802,153 E1425K probably damaging Het
Olfr350 T C 2: 36,850,834 S263P possibly damaging Het
Pcm1 T A 8: 41,283,632 M884K probably damaging Het
Phf20 T A 2: 156,298,653 L749H probably damaging Het
Pigp T C 16: 94,370,367 R22G probably null Het
Polr2b T C 5: 77,320,977 M200T probably damaging Het
Ppig T A 2: 69,750,127 D668E unknown Het
Prss3 G A 6: 41,375,126 R68C probably benign Het
Retreg3 G A 11: 101,103,895 probably benign Het
Shank1 T C 7: 44,357,206 F2116L possibly damaging Het
Spg21 T C 9: 65,468,808 S33P possibly damaging Het
Spns3 A G 11: 72,499,523 S432P probably damaging Het
Stra6 A G 9: 58,135,169 E27G probably damaging Het
Tanc1 A G 2: 59,842,976 Q1468R probably benign Het
Tbce T G 13: 14,019,777 E99A probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trim10 A G 17: 36,877,031 T380A probably damaging Het
Trim31 T A 17: 36,909,609 D472E probably damaging Het
Vmn2r28 G A 7: 5,488,004 Q415* probably null Het
Vwf G A 6: 125,649,289 C7Y unknown Het
Yeats2 C T 16: 20,214,475 P1088L probably benign Het
Zfp40 C A 17: 23,178,380 V48L possibly damaging Het
Other mutations in Nup43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Nup43 APN 10 7669556 missense probably benign
IGL02029:Nup43 APN 10 7667583 missense possibly damaging 0.87
IGL02375:Nup43 APN 10 7673594 missense probably damaging 1.00
R0413:Nup43 UTSW 10 7671027 missense probably benign 0.05
R1061:Nup43 UTSW 10 7667671 missense probably damaging 0.99
R1892:Nup43 UTSW 10 7673609 missense probably damaging 0.99
R2960:Nup43 UTSW 10 7670949 missense probably benign
R3551:Nup43 UTSW 10 7675014 missense possibly damaging 0.93
R4772:Nup43 UTSW 10 7678669 nonsense probably null
R6346:Nup43 UTSW 10 7675062 missense probably damaging 1.00
R8073:Nup43 UTSW 10 7670949 missense probably benign
R8220:Nup43 UTSW 10 7676333 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTTAGTGGTACAGAGTCAGCC -3'
(R):5'- TTACAAATGCCACTTTCTGGTG -3'

Sequencing Primer
(F):5'- TCAGGACATAAACTCTGAGCTGCTG -3'
(R):5'- GCCACTTTCTGGTGATAAAATTTTG -3'
Posted On2017-10-10