Incidental Mutation 'R0524:Smarce1'
ID48795
Institutional Source Beutler Lab
Gene Symbol Smarce1
Ensembl Gene ENSMUSG00000037935
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
Synonyms2810417B20Rik, BAF57, 9030408N19Rik, 5830412H02Rik
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0524 (G1)
Quality Score207
Status Not validated
Chromosome11
Chromosomal Location99209047-99231017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99214062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 263 (T263M)
Ref Sequence ENSEMBL: ENSMUSP00000099422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103133]
Predicted Effect probably damaging
Transcript: ENSMUST00000103133
AA Change: T263M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099422
Gene: ENSMUSG00000037935
AA Change: T263M

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
HMG 65 135 8.37e-15 SMART
low complexity region 149 163 N/A INTRINSIC
Blast:HMG 165 205 1e-20 BLAST
coiled coil region 222 319 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156160
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the large ATP-dependent chromatin remodeling complex SWI/SNF, which is required for transcriptional activation of genes normally repressed by chromatin. The encoded protein, either alone or when in the SWI/SNF complex, can bind to 4-way junction DNA, which is thought to mimic the topology of DNA as it enters or exits the nucleosome. The protein contains a DNA-binding HMG domain, but disruption of this domain does not abolish the DNA-binding or nucleosome-displacement activities of the SWI/SNF complex. Unlike most of the SWI/SNF complex proteins, this protein has no yeast counterpart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Smarce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Smarce1 APN 11 99210187 missense possibly damaging 0.69
IGL01477:Smarce1 APN 11 99210187 missense possibly damaging 0.69
IGL02256:Smarce1 APN 11 99219380 missense possibly damaging 0.63
R4721:Smarce1 UTSW 11 99220717 missense probably benign 0.01
R4953:Smarce1 UTSW 11 99215151 missense probably benign 0.45
R5002:Smarce1 UTSW 11 99225063 missense probably damaging 0.99
R7605:Smarce1 UTSW 11 99228292 missense probably benign
R8007:Smarce1 UTSW 11 99225050 missense possibly damaging 0.95
Z1176:Smarce1 UTSW 11 99210095 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTTCTATTACCTGAGGGCCTAGTC -3'
(R):5'- TGGATGCAAACTGGAGGATTTAGGGA -3'

Sequencing Primer
(F):5'- TGAGGGCCTAGTCTTTATATGTATAC -3'
(R):5'- agttcagttcccagcacc -3'
Posted On2013-06-12