Mutagenetix > Incidental Mutations

Incidental Mutation 'R6179:Gtse1'

487954

Institutional Source

Beutler Lab

Gene Symbol

Gtse1

Ensembl Gene

ENSMUSG00000022385

Gene Name

G two S phase expressed protein 1

Synonyms

B99, Gtse-1

MMRRC Submission

044321-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R6179 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85859745-85876573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 85868957 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 424 (N424K)

Ref Sequence

ENSEMBL: ENSMUSP00000155552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170629] [ENSMUST00000231074]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170629
AA Change: N424K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: N424K

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	10	153	3e-62	PFAM
low complexity region	284	301	N/A	INTRINSIC
low complexity region	310	321	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC
low complexity region	478	497	N/A	INTRINSIC
low complexity region	568	593	N/A	INTRINSIC
low complexity region	644	653	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231074
AA Change: N424K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930426L09Rik	T	C	2: 18,998,842		probably benign	Het
4930590J08Rik	T	C	6: 91,942,330	S657P	probably damaging	Het
Abca9	T	C	11: 110,134,254	I988V	probably benign	Het
Aox4	T	A	1: 58,231,503	D280E	probably benign	Het
Apob	T	A	12: 8,005,060	L1353*	probably null	Het
Atp2b1	C	T	10: 99,022,829	R222C	probably damaging	Het
AW209491	T	G	13: 14,637,083	S174A	possibly damaging	Het
B930094E09Rik	G	C	18: 31,609,858		probably benign	Het
Cbln3	G	T	14: 55,884,060	P43Q	possibly damaging	Het
Ccdc181	A	T	1: 164,279,918	T57S	probably benign	Het
Ccr2	A	C	9: 124,105,971	N96T	probably damaging	Het
Cep131	T	C	11: 120,066,011	I868V	probably benign	Het
Chd2	A	G	7: 73,444,323	I1535T	probably damaging	Het
Chl1	A	T	6: 103,683,243	T377S	probably benign	Het
Cpeb3	A	G	19: 37,088,453	F439L	probably damaging	Het
Crb2	T	C	2: 37,790,257	V399A	probably damaging	Het
Cry2	C	T	2: 92,413,842	G329R	probably damaging	Het
Dock4	A	G	12: 40,731,869	E691G	probably benign	Het
Edil3	A	T	13: 88,821,989	H3L	probably benign	Het
Endod1	T	C	9: 14,357,461	I243V	probably benign	Het
Fpr3	G	A	17: 17,970,657	W63*	probably null	Het
Gm498	A	G	7: 143,871,787	T58A	probably benign	Het
Kcnt1	G	A	2: 25,893,180	V252M	probably damaging	Het
Kif1bp	G	A	10: 62,563,250	Q130*	probably null	Het
Lmbrd2	T	G	15: 9,149,175	I48M	probably damaging	Het
Lrrc7	T	G	3: 158,353,432	I13L	probably damaging	Het
Mbd4	A	G	6: 115,845,425	S408P	probably benign	Het
Mphosph10	A	G	7: 64,378,781	V542A	possibly damaging	Het
Msto1	C	A	3: 88,910,947	R331L	probably damaging	Het
Myh10	G	A	11: 68,802,153	E1425K	probably damaging	Het
Nup43	T	C	10: 7,678,673	I340T	probably benign	Het
Olfr350	T	C	2: 36,850,834	S263P	possibly damaging	Het
Pcm1	T	A	8: 41,283,632	M884K	probably damaging	Het
Phf20	T	A	2: 156,298,653	L749H	probably damaging	Het
Pigp	T	C	16: 94,370,367	R22G	probably null	Het
Polr2b	T	C	5: 77,320,977	M200T	probably damaging	Het
Ppig	T	A	2: 69,750,127	D668E	unknown	Het
Prss3	G	A	6: 41,375,126	R68C	probably benign	Het
Retreg3	G	A	11: 101,103,895		probably benign	Het
Shank1	T	C	7: 44,357,206	F2116L	possibly damaging	Het
Spg21	T	C	9: 65,468,808	S33P	possibly damaging	Het
Spns3	A	G	11: 72,499,523	S432P	probably damaging	Het
Stra6	A	G	9: 58,135,169	E27G	probably damaging	Het
Tanc1	A	G	2: 59,842,976	Q1468R	probably benign	Het
Tbce	T	G	13: 14,019,777	E99A	probably benign	Het
Tmem106b	T	C	6: 13,084,253	V252A	probably damaging	Het
Trim10	A	G	17: 36,877,031	T380A	probably damaging	Het
Trim31	T	A	17: 36,909,609	D472E	probably damaging	Het
Vmn2r28	G	A	7: 5,488,004	Q415*	probably null	Het
Vwf	G	A	6: 125,649,289	C7Y	unknown	Het
Yeats2	C	T	16: 20,214,475	P1088L	probably benign	Het
Zfp40	C	A	17: 23,178,380	V48L	possibly damaging	Het

Other mutations in Gtse1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Gtse1	APN	15	85868817	missense	possibly damaging	0.54
IGL01344:Gtse1	APN	15	85862066	critical splice acceptor site	probably null
IGL01541:Gtse1	APN	15	85875654	nonsense	probably null
IGL01621:Gtse1	APN	15	85875082	missense	probably benign	0.01
IGL01945:Gtse1	APN	15	85871547	missense	probably benign	0.00
IGL02193:Gtse1	APN	15	85862330	missense	probably benign	0.27
IGL02215:Gtse1	APN	15	85862598	missense	possibly damaging	0.92
IGL02494:Gtse1	APN	15	85867503	missense	probably damaging	1.00
IGL02879:Gtse1	APN	15	85869063	splice site	probably benign
R0009:Gtse1	UTSW	15	85862435	missense	probably benign	0.06
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0576:Gtse1	UTSW	15	85869051	missense	probably damaging	1.00
R1078:Gtse1	UTSW	15	85862307	missense	probably damaging	0.98
R1442:Gtse1	UTSW	15	85860102	splice site	probably benign
R1623:Gtse1	UTSW	15	85867578	missense	probably benign
R1925:Gtse1	UTSW	15	85873738	missense	probably benign	0.00
R1928:Gtse1	UTSW	15	85862063	splice site	probably benign
R4565:Gtse1	UTSW	15	85875184	missense	probably damaging	0.99
R5170:Gtse1	UTSW	15	85864264	critical splice donor site	probably null
R5310:Gtse1	UTSW	15	85873792	missense	probably benign	0.04
R5428:Gtse1	UTSW	15	85862139	missense	probably benign	0.12
R5748:Gtse1	UTSW	15	85867577	missense	probably benign
R5996:Gtse1	UTSW	15	85864180	missense	probably benign	0.00
R6379:Gtse1	UTSW	15	85864224	missense	probably benign	0.01
R6381:Gtse1	UTSW	15	85862148	missense	probably benign	0.00
R6434:Gtse1	UTSW	15	85875169	missense	probably benign	0.21
R7086:Gtse1	UTSW	15	85875549	missense	probably damaging	1.00
R7304:Gtse1	UTSW	15	85871547	missense	probably benign	0.00
R7485:Gtse1	UTSW	15	85868700	missense	probably benign	0.04
R7580:Gtse1	UTSW	15	85862231	missense	probably damaging	1.00
R7856:Gtse1	UTSW	15	85864141	missense	probably benign	0.09
R8496:Gtse1	UTSW	15	85862082	missense	probably damaging	1.00
Z1176:Gtse1	UTSW	15	85868746	missense	possibly damaging	0.85
Z1177:Gtse1	UTSW	15	85875737	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTCAGGCAGAATAGGACCC -3'
(R):5'- ACACCCTGGACAGAGTATCAGAG -3'

Sequencing Primer
(F):5'- GTCACGCCAGGCTTTGC -3'
(R):5'- CCCTGGACAGAGTATCAGAGCTAAAG -3'

Posted On

2017-10-10