Incidental Mutation 'R6179:Gtse1'
ID487954
Institutional Source Beutler Lab
Gene Symbol Gtse1
Ensembl Gene ENSMUSG00000022385
Gene NameG two S phase expressed protein 1
SynonymsB99, Gtse-1
MMRRC Submission 044321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6179 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85859745-85876573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85868957 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 424 (N424K)
Ref Sequence ENSEMBL: ENSMUSP00000155552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170629] [ENSMUST00000231074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170629
AA Change: N424K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: N424K

DomainStartEndE-ValueType
Pfam:GTSE1_N 10 153 3e-62 PFAM
low complexity region 284 301 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
low complexity region 568 593 N/A INTRINSIC
low complexity region 644 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231074
AA Change: N424K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930426L09Rik T C 2: 18,998,842 probably benign Het
4930590J08Rik T C 6: 91,942,330 S657P probably damaging Het
Abca9 T C 11: 110,134,254 I988V probably benign Het
Aox4 T A 1: 58,231,503 D280E probably benign Het
Apob T A 12: 8,005,060 L1353* probably null Het
Atp2b1 C T 10: 99,022,829 R222C probably damaging Het
AW209491 T G 13: 14,637,083 S174A possibly damaging Het
B930094E09Rik G C 18: 31,609,858 probably benign Het
Cbln3 G T 14: 55,884,060 P43Q possibly damaging Het
Ccdc181 A T 1: 164,279,918 T57S probably benign Het
Ccr2 A C 9: 124,105,971 N96T probably damaging Het
Cep131 T C 11: 120,066,011 I868V probably benign Het
Chd2 A G 7: 73,444,323 I1535T probably damaging Het
Chl1 A T 6: 103,683,243 T377S probably benign Het
Cpeb3 A G 19: 37,088,453 F439L probably damaging Het
Crb2 T C 2: 37,790,257 V399A probably damaging Het
Cry2 C T 2: 92,413,842 G329R probably damaging Het
Dock4 A G 12: 40,731,869 E691G probably benign Het
Edil3 A T 13: 88,821,989 H3L probably benign Het
Endod1 T C 9: 14,357,461 I243V probably benign Het
Fpr3 G A 17: 17,970,657 W63* probably null Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Kcnt1 G A 2: 25,893,180 V252M probably damaging Het
Kif1bp G A 10: 62,563,250 Q130* probably null Het
Lmbrd2 T G 15: 9,149,175 I48M probably damaging Het
Lrrc7 T G 3: 158,353,432 I13L probably damaging Het
Mbd4 A G 6: 115,845,425 S408P probably benign Het
Mphosph10 A G 7: 64,378,781 V542A possibly damaging Het
Msto1 C A 3: 88,910,947 R331L probably damaging Het
Myh10 G A 11: 68,802,153 E1425K probably damaging Het
Nup43 T C 10: 7,678,673 I340T probably benign Het
Olfr350 T C 2: 36,850,834 S263P possibly damaging Het
Pcm1 T A 8: 41,283,632 M884K probably damaging Het
Phf20 T A 2: 156,298,653 L749H probably damaging Het
Pigp T C 16: 94,370,367 R22G probably null Het
Polr2b T C 5: 77,320,977 M200T probably damaging Het
Ppig T A 2: 69,750,127 D668E unknown Het
Prss3 G A 6: 41,375,126 R68C probably benign Het
Retreg3 G A 11: 101,103,895 probably benign Het
Shank1 T C 7: 44,357,206 F2116L possibly damaging Het
Spg21 T C 9: 65,468,808 S33P possibly damaging Het
Spns3 A G 11: 72,499,523 S432P probably damaging Het
Stra6 A G 9: 58,135,169 E27G probably damaging Het
Tanc1 A G 2: 59,842,976 Q1468R probably benign Het
Tbce T G 13: 14,019,777 E99A probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trim10 A G 17: 36,877,031 T380A probably damaging Het
Trim31 T A 17: 36,909,609 D472E probably damaging Het
Vmn2r28 G A 7: 5,488,004 Q415* probably null Het
Vwf G A 6: 125,649,289 C7Y unknown Het
Yeats2 C T 16: 20,214,475 P1088L probably benign Het
Zfp40 C A 17: 23,178,380 V48L possibly damaging Het
Other mutations in Gtse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gtse1 APN 15 85868817 missense possibly damaging 0.54
IGL01344:Gtse1 APN 15 85862066 critical splice acceptor site probably null
IGL01541:Gtse1 APN 15 85875654 nonsense probably null
IGL01621:Gtse1 APN 15 85875082 missense probably benign 0.01
IGL01945:Gtse1 APN 15 85871547 missense probably benign 0.00
IGL02193:Gtse1 APN 15 85862330 missense probably benign 0.27
IGL02215:Gtse1 APN 15 85862598 missense possibly damaging 0.92
IGL02494:Gtse1 APN 15 85867503 missense probably damaging 1.00
IGL02879:Gtse1 APN 15 85869063 splice site probably benign
R0009:Gtse1 UTSW 15 85862435 missense probably benign 0.06
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0576:Gtse1 UTSW 15 85869051 missense probably damaging 1.00
R1078:Gtse1 UTSW 15 85862307 missense probably damaging 0.98
R1442:Gtse1 UTSW 15 85860102 splice site probably benign
R1623:Gtse1 UTSW 15 85867578 missense probably benign
R1925:Gtse1 UTSW 15 85873738 missense probably benign 0.00
R1928:Gtse1 UTSW 15 85862063 splice site probably benign
R4565:Gtse1 UTSW 15 85875184 missense probably damaging 0.99
R5170:Gtse1 UTSW 15 85864264 critical splice donor site probably null
R5310:Gtse1 UTSW 15 85873792 missense probably benign 0.04
R5428:Gtse1 UTSW 15 85862139 missense probably benign 0.12
R5748:Gtse1 UTSW 15 85867577 missense probably benign
R5996:Gtse1 UTSW 15 85864180 missense probably benign 0.00
R6379:Gtse1 UTSW 15 85864224 missense probably benign 0.01
R6381:Gtse1 UTSW 15 85862148 missense probably benign 0.00
R6434:Gtse1 UTSW 15 85875169 missense probably benign 0.21
R7086:Gtse1 UTSW 15 85875549 missense probably damaging 1.00
R7304:Gtse1 UTSW 15 85871547 missense probably benign 0.00
R7485:Gtse1 UTSW 15 85868700 missense probably benign 0.04
R7580:Gtse1 UTSW 15 85862231 missense probably damaging 1.00
R7856:Gtse1 UTSW 15 85864141 missense probably benign 0.09
R8496:Gtse1 UTSW 15 85862082 missense probably damaging 1.00
Z1176:Gtse1 UTSW 15 85868746 missense possibly damaging 0.85
Z1177:Gtse1 UTSW 15 85875737 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCAGGCAGAATAGGACCC -3'
(R):5'- ACACCCTGGACAGAGTATCAGAG -3'

Sequencing Primer
(F):5'- GTCACGCCAGGCTTTGC -3'
(R):5'- CCCTGGACAGAGTATCAGAGCTAAAG -3'
Posted On2017-10-10