Incidental Mutation 'R6179:Pigp'
ID487956
Institutional Source Beutler Lab
Gene Symbol Pigp
Ensembl Gene ENSMUSG00000022940
Gene Namephosphatidylinositol glycan anchor biosynthesis, class P
SynonymsDcrc, Dscr5
MMRRC Submission 044321-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R6179 (G1)
Quality Score183.009
Status Not validated
Chromosome16
Chromosomal Location94358763-94371842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94370367 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 22 (R22G)
Ref Sequence ENSEMBL: ENSMUSP00000109543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113905] [ENSMUST00000113906] [ENSMUST00000113910] [ENSMUST00000113914] [ENSMUST00000113917] [ENSMUST00000117648] [ENSMUST00000119131] [ENSMUST00000122895] [ENSMUST00000138514] [ENSMUST00000139513] [ENSMUST00000141856] [ENSMUST00000143145] [ENSMUST00000145432] [ENSMUST00000145883] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000149885] [ENSMUST00000150097] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153062] [ENSMUST00000153988] [ENSMUST00000154243] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000232294]
Predicted Effect probably benign
Transcript: ENSMUST00000113905
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113906
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113910
AA Change: R22G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940
AA Change: R22G

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113914
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113917
SMART Domains Protein: ENSMUSP00000109550
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 43 135 5.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117648
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119131
SMART Domains Protein: ENSMUSP00000113311
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 229 285 1.1e-12 PFAM
Pfam:TPR_1 232 264 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122895
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127667
SMART Domains Protein: ENSMUSP00000122425
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 22 89 4.7e-16 PFAM
Pfam:TPR_2 24 57 5.7e-4 PFAM
Pfam:TPR_1 25 57 3.5e-5 PFAM
Pfam:TPR_9 35 103 3.2e-6 PFAM
Pfam:TPR_1 58 89 2.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130960
Predicted Effect probably benign
Transcript: ENSMUST00000138514
SMART Domains Protein: ENSMUSP00000114477
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 43 152 1.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139513
SMART Domains Protein: ENSMUSP00000117881
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141856
SMART Domains Protein: ENSMUSP00000117369
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_1 90 121 1e-6 PFAM
Pfam:TPR_2 90 121 7.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000145432
Predicted Effect probably benign
Transcript: ENSMUST00000145883
SMART Domains Protein: ENSMUSP00000123442
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146924
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147352
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149753
Predicted Effect probably benign
Transcript: ENSMUST00000149885
SMART Domains Protein: ENSMUSP00000122006
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_2 1 31 3.5e-4 PFAM
Pfam:TPR_11 1 58 7.8e-16 PFAM
Pfam:TPR_1 2 31 1.8e-5 PFAM
Pfam:TPR_9 9 58 2.5e-6 PFAM
Pfam:TPR_17 20 53 4.2e-7 PFAM
Pfam:TPR_1 32 58 2.5e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150097
SMART Domains Protein: ENSMUSP00000119035
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150346
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151192
Predicted Effect probably benign
Transcript: ENSMUST00000151770
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152117
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153062
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154243
Predicted Effect probably benign
Transcript: ENSMUST00000155692
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231569
Predicted Effect probably benign
Transcript: ENSMUST00000232294
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930426L09Rik T C 2: 18,998,842 probably benign Het
4930590J08Rik T C 6: 91,942,330 S657P probably damaging Het
Abca9 T C 11: 110,134,254 I988V probably benign Het
Aox4 T A 1: 58,231,503 D280E probably benign Het
Apob T A 12: 8,005,060 L1353* probably null Het
Atp2b1 C T 10: 99,022,829 R222C probably damaging Het
AW209491 T G 13: 14,637,083 S174A possibly damaging Het
B930094E09Rik G C 18: 31,609,858 probably benign Het
Cbln3 G T 14: 55,884,060 P43Q possibly damaging Het
Ccdc181 A T 1: 164,279,918 T57S probably benign Het
Ccr2 A C 9: 124,105,971 N96T probably damaging Het
Cep131 T C 11: 120,066,011 I868V probably benign Het
Chd2 A G 7: 73,444,323 I1535T probably damaging Het
Chl1 A T 6: 103,683,243 T377S probably benign Het
Cpeb3 A G 19: 37,088,453 F439L probably damaging Het
Crb2 T C 2: 37,790,257 V399A probably damaging Het
Cry2 C T 2: 92,413,842 G329R probably damaging Het
Dock4 A G 12: 40,731,869 E691G probably benign Het
Edil3 A T 13: 88,821,989 H3L probably benign Het
Endod1 T C 9: 14,357,461 I243V probably benign Het
Fpr3 G A 17: 17,970,657 W63* probably null Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gtse1 T G 15: 85,868,957 N424K possibly damaging Het
Kcnt1 G A 2: 25,893,180 V252M probably damaging Het
Kif1bp G A 10: 62,563,250 Q130* probably null Het
Lmbrd2 T G 15: 9,149,175 I48M probably damaging Het
Lrrc7 T G 3: 158,353,432 I13L probably damaging Het
Mbd4 A G 6: 115,845,425 S408P probably benign Het
Mphosph10 A G 7: 64,378,781 V542A possibly damaging Het
Msto1 C A 3: 88,910,947 R331L probably damaging Het
Myh10 G A 11: 68,802,153 E1425K probably damaging Het
Nup43 T C 10: 7,678,673 I340T probably benign Het
Olfr350 T C 2: 36,850,834 S263P possibly damaging Het
Pcm1 T A 8: 41,283,632 M884K probably damaging Het
Phf20 T A 2: 156,298,653 L749H probably damaging Het
Polr2b T C 5: 77,320,977 M200T probably damaging Het
Ppig T A 2: 69,750,127 D668E unknown Het
Prss3 G A 6: 41,375,126 R68C probably benign Het
Retreg3 G A 11: 101,103,895 probably benign Het
Shank1 T C 7: 44,357,206 F2116L possibly damaging Het
Spg21 T C 9: 65,468,808 S33P possibly damaging Het
Spns3 A G 11: 72,499,523 S432P probably damaging Het
Stra6 A G 9: 58,135,169 E27G probably damaging Het
Tanc1 A G 2: 59,842,976 Q1468R probably benign Het
Tbce T G 13: 14,019,777 E99A probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trim10 A G 17: 36,877,031 T380A probably damaging Het
Trim31 T A 17: 36,909,609 D472E probably damaging Het
Vmn2r28 G A 7: 5,488,004 Q415* probably null Het
Vwf G A 6: 125,649,289 C7Y unknown Het
Yeats2 C T 16: 20,214,475 P1088L probably benign Het
Zfp40 C A 17: 23,178,380 V48L possibly damaging Het
Other mutations in Pigp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Pigp APN 16 94364767 nonsense probably null
IGL02728:Pigp APN 16 94367607 missense probably damaging 1.00
schweinchen UTSW 16 94365441 missense probably damaging 1.00
R0092:Pigp UTSW 16 94365462 missense probably damaging 0.96
R3614:Pigp UTSW 16 94364724 missense possibly damaging 0.91
R4872:Pigp UTSW 16 94365450 missense probably benign 0.18
R4959:Pigp UTSW 16 94359147 missense probably benign 0.00
R4973:Pigp UTSW 16 94359147 missense probably benign 0.00
R5970:Pigp UTSW 16 94370194 critical splice acceptor site probably null
R6135:Pigp UTSW 16 94370206 missense probably benign 0.20
R6732:Pigp UTSW 16 94365441 missense probably damaging 1.00
R7576:Pigp UTSW 16 94370405 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCGACGGTGAATTTTCCACC -3'
(R):5'- CTGCGCATTGGACTGAGTGG -3'

Sequencing Primer
(F):5'- CCCTGTGGCTTTAGACAATCTGTG -3'
(R):5'- ATTGGACTGAGTGGGGCTGAAG -3'
Posted On2017-10-10