Incidental Mutation 'R0524:Aoc3'
List |< first << previous [record 3 of 51] next >> last >|
ID48796
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Nameamine oxidase, copper containing 3
Synonymssemicarbazide-sensitive amine oxidase, SSAO, VAP1
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101330605-101341938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101337511 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 715 (P715T)
Ref Sequence ENSEMBL: ENSMUSP00000099394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000103105]
Predicted Effect probably damaging
Transcript: ENSMUST00000017316
AA Change: P435T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326
AA Change: P435T

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103105
AA Change: P715T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326
AA Change: P715T

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187880
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101337478 missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101337595 missense probably benign
IGL02500:Aoc3 APN 11 101337389 nonsense probably null
R0463:Aoc3 UTSW 11 101331606 missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101332138 missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101336447 missense possibly damaging 0.84
R0740:Aoc3 UTSW 11 101332332 missense probably benign 0.01
R0946:Aoc3 UTSW 11 101332305 missense possibly damaging 0.89
R1723:Aoc3 UTSW 11 101336435 missense possibly damaging 0.82
R1869:Aoc3 UTSW 11 101331467 nonsense probably null
R3735:Aoc3 UTSW 11 101332219 missense probably damaging 0.99
R4497:Aoc3 UTSW 11 101332045 missense possibly damaging 0.70
R4613:Aoc3 UTSW 11 101337659 intron probably benign
R4858:Aoc3 UTSW 11 101331662 missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101332099 missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101330974 missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101331752 nonsense probably null
R6679:Aoc3 UTSW 11 101331453 missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101337403 missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101332512 missense probably benign 0.00
R7888:Aoc3 UTSW 11 101332497 missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101332306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCCGAAGTGGCCTGTAGTG -3'
(R):5'- GCTAGATTGTCCATCTTGGGGACAC -3'

Sequencing Primer
(F):5'- TATCCTTCTGGGACATCCAAAAGAG -3'
(R):5'- CATCTTGGGGACACTTAATGGC -3'
Posted On2013-06-12