Incidental Mutation 'R6180:Lhx3'
ID487969
Institutional Source Beutler Lab
Gene Symbol Lhx3
Ensembl Gene ENSMUSG00000026934
Gene NameLIM homeobox protein 3
SynonymsmLim-3, Lim3, P-LIM
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6180 (G1)
Quality Score194.009
Status Not validated
Chromosome2
Chromosomal Location26200212-26208289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26201491 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 269 (M269L)
Ref Sequence ENSEMBL: ENSMUSP00000056822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028302] [ENSMUST00000054099]
PDB Structure
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028302
AA Change: M271L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028302
Gene: ENSMUSG00000026934
AA Change: M271L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
LIM 35 86 4.18e-17 SMART
LIM 94 149 7.8e-17 SMART
HOX 162 224 7.13e-23 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054099
AA Change: M269L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056822
Gene: ENSMUSG00000026934
AA Change: M269L

DomainStartEndE-ValueType
LIM 33 84 4.18e-17 SMART
LIM 92 147 7.8e-17 SMART
HOX 160 222 7.13e-23 SMART
low complexity region 235 247 N/A INTRINSIC
low complexity region 321 340 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127035
SMART Domains Protein: ENSMUSP00000134884
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 6.2e-5 PFAM
low complexity region 35 47 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149637
SMART Domains Protein: ENSMUSP00000135765
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failure of growth and differentiation of Rathke's pouch, lack both anterior and intermediate lobes of the pituitary gland, and die perinatally, within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
Ap4e1 T A 2: 127,066,588 C1085* probably null Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Ccser2 A T 14: 36,940,319 S303T probably benign Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Flrt2 C T 12: 95,779,238 Q117* probably null Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nav2 A G 7: 49,458,167 H647R probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Pot1a A T 6: 25,771,621 D200E probably benign Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Scn11a T C 9: 119,754,867 I1561V probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Lhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Lhx3 APN 2 26201373 missense probably benign
IGL02691:Lhx3 APN 2 26203085 missense probably damaging 1.00
R0267:Lhx3 UTSW 2 26203028 missense probably benign 0.02
R0571:Lhx3 UTSW 2 26201124 missense probably damaging 1.00
R0574:Lhx3 UTSW 2 26201311 missense probably benign 0.00
R1866:Lhx3 UTSW 2 26203974 missense probably damaging 0.99
R1926:Lhx3 UTSW 2 26202188 nonsense probably null
R1940:Lhx3 UTSW 2 26203962 missense probably benign 0.05
R3147:Lhx3 UTSW 2 26201265 missense probably benign 0.01
R4389:Lhx3 UTSW 2 26201090 utr 3 prime probably benign
R4534:Lhx3 UTSW 2 26204014 missense probably benign
R4551:Lhx3 UTSW 2 26201190 missense probably damaging 1.00
R4761:Lhx3 UTSW 2 26201423 frame shift probably null
R5102:Lhx3 UTSW 2 26201423 frame shift probably null
R5105:Lhx3 UTSW 2 26201423 frame shift probably null
R5431:Lhx3 UTSW 2 26201118 missense probably damaging 1.00
R5673:Lhx3 UTSW 2 26202994 missense probably damaging 1.00
R5751:Lhx3 UTSW 2 26201161 missense probably benign
R6262:Lhx3 UTSW 2 26202423 small deletion probably benign
R7238:Lhx3 UTSW 2 26202997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCAAGTTGGTGTCTG -3'
(R):5'- GCTAAGTTCTGAGAGTGCTGAAG -3'

Sequencing Primer
(F):5'- CTCAAGTTGGTGTCTGGGTATACC -3'
(R):5'- TGCTGAAGAGACTGTCCCTGAC -3'
Posted On2017-10-10