Incidental Mutation 'R6180:Ap4e1'
ID487973
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Nameadaptor-related protein complex AP-4, epsilon 1
Synonyms2310033A20Rik
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6180 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127008717-127067909 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 127066588 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1085 (C1085*)
Ref Sequence ENSEMBL: ENSMUSP00000002063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000002064] [ENSMUST00000110389] [ENSMUST00000135529]
Predicted Effect probably null
Transcript: ENSMUST00000002063
AA Change: C1085*
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: C1085*

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002064
SMART Domains Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 2.1e-22 PFAM
Pfam:Biliv-reduc_cat 132 244 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110389
SMART Domains Protein: ENSMUSP00000106019
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135529
SMART Domains Protein: ENSMUSP00000118278
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 1e-22 PFAM
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142861
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Ccser2 A T 14: 36,940,319 S303T probably benign Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Flrt2 C T 12: 95,779,238 Q117* probably null Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lhx3 T A 2: 26,201,491 M269L probably benign Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nav2 A G 7: 49,458,167 H647R probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Pot1a A T 6: 25,771,621 D200E probably benign Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Scn11a T C 9: 119,754,867 I1561V probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 127028281 missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 127028289 missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 127063301 missense probably benign 0.30
IGL01155:Ap4e1 APN 2 127043445 missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 127052189 missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 127046910 missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 127043511 missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 127061929 missense probably benign
IGL02207:Ap4e1 APN 2 127011816 missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 127063397 missense probably benign 0.18
quickstep UTSW 2 127008902 critical splice donor site probably null
K7371:Ap4e1 UTSW 2 127066536 unclassified probably benign
R0090:Ap4e1 UTSW 2 127064985 missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 127049360 missense probably damaging 1.00
R0490:Ap4e1 UTSW 2 127046186 missense probably damaging 1.00
R0632:Ap4e1 UTSW 2 127049280 nonsense probably null
R0670:Ap4e1 UTSW 2 127011864 critical splice donor site probably null
R0698:Ap4e1 UTSW 2 127063363 missense probably benign 0.00
R1183:Ap4e1 UTSW 2 127014201 missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 127046909 missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 127061555 missense probably null 1.00
R1528:Ap4e1 UTSW 2 127011823 missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 127061547 missense probably benign 0.00
R2270:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R2271:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R3108:Ap4e1 UTSW 2 127056306 critical splice donor site probably null
R4019:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4020:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4454:Ap4e1 UTSW 2 127047141 missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 127061871 missense probably benign 0.08
R4767:Ap4e1 UTSW 2 127060438 missense probably benign
R4803:Ap4e1 UTSW 2 127049559 missense probably benign 0.20
R4804:Ap4e1 UTSW 2 127043758 critical splice donor site probably null
R5155:Ap4e1 UTSW 2 127063369 missense probably benign 0.02
R5157:Ap4e1 UTSW 2 127061695 missense probably benign 0.00
R5248:Ap4e1 UTSW 2 127064922 missense possibly damaging 0.95
R5363:Ap4e1 UTSW 2 127037864 splice site probably null
R5507:Ap4e1 UTSW 2 127008898 missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 127064979 missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 127028160 splice site probably null
R6298:Ap4e1 UTSW 2 127047115 missense probably benign 0.00
R6329:Ap4e1 UTSW 2 127061716 missense probably benign 0.10
R6543:Ap4e1 UTSW 2 127066605 missense probably benign 0.03
R6954:Ap4e1 UTSW 2 127064951 missense probably benign 0.01
R7144:Ap4e1 UTSW 2 127011807 missense probably damaging 0.99
R7165:Ap4e1 UTSW 2 127063318 missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 127061976 missense probably damaging 0.96
R7348:Ap4e1 UTSW 2 127061977 missense possibly damaging 0.76
R7382:Ap4e1 UTSW 2 127008902 critical splice donor site probably null
R7571:Ap4e1 UTSW 2 127019336 missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 127046934 missense probably damaging 1.00
X0060:Ap4e1 UTSW 2 127063410 missense probably benign 0.01
X0065:Ap4e1 UTSW 2 127061650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATAAGAGTGAAGTGCTCTCCC -3'
(R):5'- ATCACAAGTACCACGAGTGC -3'

Sequencing Primer
(F):5'- AGTGAAGTGCTCTCCCTAAGG -3'
(R):5'- AGTACCACGAGTGCTTTTTACTTTG -3'
Posted On2017-10-10