Incidental Mutation 'R6180:Pot1a'
ID487987
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Nameprotection of telomeres 1A
Synonyms1500031H18Rik, Pot1
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6180 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location25743737-25809246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25771621 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 200 (D200E)
Ref Sequence ENSEMBL: ENSMUSP00000131928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115327] [ENSMUST00000115330] [ENSMUST00000166445]
Predicted Effect probably benign
Transcript: ENSMUST00000115327
AA Change: D200E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110982
Gene: ENSMUSG00000029676
AA Change: D200E

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115329
SMART Domains Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115330
AA Change: D200E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: D200E

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156985
Predicted Effect probably benign
Transcript: ENSMUST00000166445
AA Change: D200E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: D200E

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
Ap4e1 T A 2: 127,066,588 C1085* probably null Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Ccser2 A T 14: 36,940,319 S303T probably benign Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Flrt2 C T 12: 95,779,238 Q117* probably null Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lhx3 T A 2: 26,201,491 M269L probably benign Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nav2 A G 7: 49,458,167 H647R probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Scn11a T C 9: 119,754,867 I1561V probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GGCCATGTAATTTTAAAGGCAGC -3'
(R):5'- AGATGGCTATACACGGTTTTAAGG -3'

Sequencing Primer
(F):5'- TAATTTTAAAGGCAGCAAGGAATAGG -3'
(R):5'- CACGGTTTTAAGGTACTGGATACTC -3'
Posted On2017-10-10