Incidental Mutation 'R6180:Nav2'
ID487999
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R6180 (G1)
Quality Score187.009
Status Not validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49458167 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 647 (H647R)
Ref Sequence ENSEMBL: ENSMUSP00000139309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064383
SMART Domains Protein: ENSMUSP00000066835
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
Blast:CH 18 79 2e-35 BLAST
PDB:2YRN|A 18 80 3e-33 PDB
SCOP:d1dxxa1 29 81 4e-15 SMART
low complexity region 94 102 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
coiled coil region 378 408 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064395
AA Change: H708R

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: H708R

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
AA Change: H647R

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: H647R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184155
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: H708R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: H708R

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
Ap4e1 T A 2: 127,066,588 C1085* probably null Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Ccser2 A T 14: 36,940,319 S303T probably benign Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Flrt2 C T 12: 95,779,238 Q117* probably null Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lhx3 T A 2: 26,201,491 M269L probably benign Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Pot1a A T 6: 25,771,621 D200E probably benign Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Scn11a T C 9: 119,754,867 I1561V probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49551773 missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49554203 splice site probably null
R7451:Nav2 UTSW 7 49552829 splice site probably null
R7545:Nav2 UTSW 7 49582857 missense probably damaging 1.00
R7706:Nav2 UTSW 7 49594319 missense probably benign 0.35
R7730:Nav2 UTSW 7 49572397 missense probably damaging 1.00
R7812:Nav2 UTSW 7 49597173 missense probably benign 0.13
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49452761 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49594223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTTTCTGGGCTCAGTCAC -3'
(R):5'- CAGGAGCTACAGTTTTGGGG -3'

Sequencing Primer
(F):5'- AGTCACCCTCTCCACGTGTG -3'
(R):5'- GCTACAGTTTTGGGGAGGAAC -3'
Posted On2017-10-10