Mutagenetix > Incidental Mutation

Incidental Mutation 'R6180:St5'

488000

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

044322-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.430) question?

Stock #

R6180 (G1)

Quality Score

218.009

Status

Not validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 109556888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 218 (D218E)

Ref Sequence

ENSEMBL: ENSMUSP00000078264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]

AlphaFold

Q924W7

Predicted Effect

probably benign
Transcript: ENSMUST00000077909
AA Change: D218E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: D218E

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000079282
AA Change: D218E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: D218E

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207394

Predicted Effect

probably benign
Transcript: ENSMUST00000207745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Predicted Effect

probably benign
Transcript: ENSMUST00000208583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208981

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,273,258	M1142V	possibly damaging	Het
Adam39	A	G	8: 40,826,573	N667S	probably benign	Het
Ap4e1	T	A	2: 127,066,588	C1085*	probably null	Het
BC035044	A	T	6: 128,885,034		probably benign	Het
Capn11	T	C	17: 45,630,766	D693G	probably damaging	Het
Cavin4	A	T	4: 48,663,917	H99L	possibly damaging	Het
Ccdc86	T	C	19: 10,948,581	K218R	possibly damaging	Het
Ccno	T	C	13: 112,989,845	S283P	probably damaging	Het
Ccser2	A	T	14: 36,940,319	S303T	probably benign	Het
Cd53	T	A	3: 106,767,364	N129I	probably damaging	Het
Cd63	G	A	10: 128,912,064		probably null	Het
Cyp2j6	G	C	4: 96,536,086	L145V	probably damaging	Het
Daam2	A	G	17: 49,469,666	M797T	probably damaging	Het
Dmgdh	G	A	13: 93,752,286	V811I	possibly damaging	Het
Dpysl4	A	T	7: 139,090,334	T123S	probably damaging	Het
Erap1	A	G	13: 74,666,226	E428G	possibly damaging	Het
Fam124b	T	A	1: 80,200,185	T366S	possibly damaging	Het
Fbxw22	T	C	9: 109,386,679	D167G	probably damaging	Het
Flrt2	C	T	12: 95,779,238	Q117*	probably null	Het
Ftsj3	A	T	11: 106,253,340		probably null	Het
Ggn	A	G	7: 29,173,049	Y618C	probably damaging	Het
Glis1	T	A	4: 107,627,513	S402T	probably benign	Het
Gm13762	T	G	2: 88,973,882	N3T	probably damaging	Het
Gm4781	T	A	10: 100,396,487		noncoding transcript	Het
Gm7168	T	A	17: 13,948,596	I75K	probably damaging	Het
Gm7298	C	T	6: 121,760,823	H348Y	probably benign	Het
Gria1	G	T	11: 57,242,792	R499L	probably damaging	Het
Gtf2ird2	C	T	5: 134,216,547	T549M	probably damaging	Het
H2-M10.6	T	A	17: 36,814,286	V323E	probably damaging	Het
Hoxb3	G	A	11: 96,346,103	V336I	probably benign	Het
Il12b	G	A	11: 44,412,626	A327T	probably benign	Het
Inpp4a	C	A	1: 37,380,102	P588T	probably benign	Het
Kctd12	C	A	14: 102,981,591	D284Y	probably damaging	Het
Kif28	C	A	1: 179,697,772		probably null	Het
Krt2	T	C	15: 101,815,044	N332S	probably benign	Het
Lama2	G	A	10: 26,981,499	T3118I	probably benign	Het
Lgi1	T	C	19: 38,264,956	L25P	probably damaging	Het
Lhx3	T	A	2: 26,201,491	M269L	probably benign	Het
Lmtk2	A	T	5: 144,175,342	E960V	probably damaging	Het
Loxl4	A	T	19: 42,608,352	D60E	probably damaging	Het
Lrp2	T	A	2: 69,503,524	N1458Y	possibly damaging	Het
Ltn1	A	T	16: 87,427,789	S16T	probably damaging	Het
Mllt6	G	A	11: 97,678,536	A875T	possibly damaging	Het
Mpp5	C	T	12: 78,817,310	H216Y	probably benign	Het
Mrgprb4	A	T	7: 48,198,826	I118N	probably damaging	Het
Mrps7	A	G	11: 115,604,881	T82A	possibly damaging	Het
Mug2	A	G	6: 122,079,606	E1170G	probably benign	Het
Nav2	A	G	7: 49,458,167	H647R	probably benign	Het
Nbeal2	T	C	9: 110,625,147	Y2710C	probably damaging	Het
Ndc1	A	T	4: 107,411,198	I644L	possibly damaging	Het
Olfr952	A	T	9: 39,426,712	Y120N	probably damaging	Het
Padi4	A	G	4: 140,756,473	M352T	possibly damaging	Het
Pcdhgc3	C	A	18: 37,806,937	D130E	probably damaging	Het
Pde6a	A	T	18: 61,284,092		probably null	Het
Pdpn	C	T	4: 143,299,222	G12R	probably damaging	Het
Pot1a	A	T	6: 25,771,621	D200E	probably benign	Het
Ppa1	A	T	10: 61,667,652	D236V	probably benign	Het
Ptprn2	T	A	12: 116,859,119	S273T	probably benign	Het
Rasgrf2	T	C	13: 92,029,101	E297G	probably damaging	Het
Rgl1	T	C	1: 152,519,172	N750S	probably damaging	Het
Rinl	A	G	7: 28,796,940	N449D	probably benign	Het
Samd8	T	A	14: 21,775,025	H79Q	probably benign	Het
Scn11a	T	C	9: 119,754,867	I1561V	probably benign	Het
Slc39a12	T	C	2: 14,396,127	L105P	probably benign	Het
Slc7a12	A	T	3: 14,481,140		probably null	Het
Slco1a4	A	G	6: 141,817,820	I390T	possibly damaging	Het
Snta1	T	C	2: 154,377,182	N411S	probably benign	Het
Srgap2	T	C	1: 131,349,541	T323A	probably benign	Het
Ssh2	G	T	11: 77,453,465	V759L	probably benign	Het
Swap70	G	T	7: 110,269,981	R327L	probably damaging	Het
Tbc1d4	C	A	14: 101,458,770	C914F	probably benign	Het
Tbx3	A	G	5: 119,674,067	D144G	probably damaging	Het
Tgfbr2	T	C	9: 116,110,144	K205R	possibly damaging	Het
Tmem94	A	T	11: 115,791,031		probably null	Het
Usf3	T	A	16: 44,221,105	F1983I	probably damaging	Het
Ush2a	T	A	1: 188,399,871	C763*	probably null	Het
Vmn1r115	A	C	7: 20,844,715	L91V	probably damaging	Het
Vmn1r201	A	T	13: 22,475,329	I238F	possibly damaging	Het
Vmn1r28	T	A	6: 58,265,491	S106R	probably damaging	Het
Vmn1r82	T	C	7: 12,305,085	V95A	probably damaging	Het
Vrk3	A	T	7: 44,769,611	N371I	possibly damaging	Het
Wnt8b	C	A	19: 44,511,643	A223E	probably benign	Het
Xirp2	T	C	2: 67,505,577		probably null	Het
Xpo7	T	C	14: 70,682,803	N642S	probably benign	Het
Ythdc1	G	A	5: 86,828,094	R520H	possibly damaging	Het
Zfp367	T	C	13: 64,135,390	E316G	probably damaging	Het
Zfp488	T	A	14: 33,970,794	R137S	possibly damaging	Het
Zfp532	G	T	18: 65,656,471	V994L	probably benign	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
R9016:St5	UTSW	7	109540435	missense	possibly damaging	0.84
R9178:St5	UTSW	7	109557084	missense	probably benign	0.31
R9361:St5	UTSW	7	109527784	missense	probably damaging	1.00
R9564:St5	UTSW	7	109526329	missense	probably damaging	1.00
R9595:St5	UTSW	7	109556766	missense	probably damaging	0.96
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCTTCTGGATCCGGCTCAG -3'
(R):5'- TGCTGAGTTGCACTGGTACC -3'

Sequencing Primer
(F):5'- TGGATCCGGCTCAGCACTG -3'
(R):5'- CATAGCCTGGGTATCCGAGAG -3'

Posted On

2017-10-10